Difference between revisions of "Part:BBa K5317009"
Gelhoet-1998 (Talk | contribs) (→Characterization) |
Annaseidler (Talk | contribs) |
||
| (6 intermediate revisions by 2 users not shown) | |||
| Line 7: | Line 7: | ||
The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection. | The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection. | ||
| − | + | To increase the efficiency of the activated MTF-1-responsive promoter, we constructed a synthetic promoter with multiple MREa sites. Searle and colleagues described in 1985 that at least two MREa sites are necessary for the zinc-induced expression of the downstream gene, here herpes simplex virus thymidine kinase. They also showed that the positioning of the MREs in the promoter sequence had little effect on the promoter efficiency, but was increased with more MREa sites inserted. Therefore, we put a promoter together with four MREa sites positioned at the sites of the MREwt promoter (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317003 K5317003]</span>). | |
=Cloning= | =Cloning= | ||
| Line 20: | Line 20: | ||
| − | The promoter was synthesized and inserted by NEB HiFi Assembly into the pEGFP-C2 backbone plasmid (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338020 K3338020]</span>) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette. The assembled plasmid is shown in figure 1. | + | The promoter was synthesized and inserted by NEB HiFi DNA Assembly into the pEGFP-C2 backbone plasmid (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338020 K3338020]</span>) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette. The assembled plasmid is shown in figure 1. |
<html> | <html> | ||
| Line 36: | Line 36: | ||
<body> | <body> | ||
| − | <caption>Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone</caption> | + | <caption>Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone.</caption> |
<table style="width:70%"> | <table style="width:70%"> | ||
| Line 84: | Line 84: | ||
=Characterization= | =Characterization= | ||
| − | Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity and | + | Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity, and specificity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF1-mRuby2 carrying plasmid (composite part <span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317012 K5317012]</span>) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis. |
===Single-transfection experiments=== | ===Single-transfection experiments=== | ||
| Line 97: | Line 97: | ||
Figure 2: Single-transfected HEK293T cells with the 4xMREa-EGFP-C2 plasmid depicted no EGFP-signal under unstimulated conditions. Scale bar = 20 µm. | Figure 2: Single-transfected HEK293T cells with the 4xMREa-EGFP-C2 plasmid depicted no EGFP-signal under unstimulated conditions. Scale bar = 20 µm. | ||
| − | The single transfection with the 4xMREa-EGFP-C2 plasmid in HEK293T cells showed no | + | The single transfection with the 4xMREa-EGFP-C2 plasmid in HEK293T cells showed no baseline signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about the sensitivity and specificity of the promoter under homeostatic conditions. Therefore, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditions. |
===Co-transfection experiments with MTF-1=== | ===Co-transfection experiments with MTF-1=== | ||
| − | To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to second induced plasmid, carrying the 4xMREa promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double-transfection of as many cells as possible, in addition to the non- or only 4xMREa-EGFP-C2- or only MTF1-mRuby2-C2- transfected cells, is crucial for sensor functionality. | + | To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to the second induced plasmid, carrying the 4xMREa promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double-transfection of as many cells as possible, in addition to the non- or only 4xMREa-EGFP-C2- or only MTF1-mRuby2-C2- transfected cells, is crucial for sensor functionality. |
| − | Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signals intracellularly. The mRuby2 signal, which reflects the | + | Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signals intracellularly. The mRuby2 signal, which reflects the localization of MTF-1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected. |
<html> | <html> | ||
| Line 111: | Line 111: | ||
</html> | </html> | ||
| − | Figure 3: Representative microscopy images of HEK293T cells co-transfected with | + | Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF1-mRuby2-C2 together with 4xMREa-EGFP-C2. MTF-1 depicts a nuclei-localized signal, the EGFP signal is cytoplasmatic. Shown are brightfield channels (left), fluorescence channels (images in the center), and an overlay of the channels (right). |
| − | A basal expression of the promoter-driven reporter fluorophore EGFP can be seen | + | A basal expression of the promoter-driven reporter fluorophore EGFP can be seen without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1. |
====FACS analysis==== | ====FACS analysis==== | ||
| Line 121: | Line 121: | ||
<html> | <html> | ||
<center> | <center> | ||
| − | <img src="https://static.igem.wiki/teams/5317/registry/k5317009- | + | <img src="https://static.igem.wiki/teams/5317/registry/k5317009-quantification.png" style="width: 60%; height: 60%"> |
</p> | </p> | ||
</center> | </center> | ||
</html> | </html> | ||
| − | Figure 4: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the 4xMREa promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated on | + | Figure 4: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the 4xMREa promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated based on their mRuby2-positivity. n=1. |
| − | Although not continuous, a clear increase in the number of EGFP-expressing cells can be | + | Although not continuous, a clear increase in the number of EGFP-expressing cells can be recognized with increasing copper sulphate concentration in the medium. Growing from approx. 14 % to approx. 21 % of EGFP-positive cells under stimulation with 0 µM or 500 µM CuSO<sub>4</sub>, respectively. |
Even if complicated by high basal activity, the presence of copper sulphate can be detected with the 4xMREa promoter construct. | Even if complicated by high basal activity, the presence of copper sulphate can be detected with the 4xMREa promoter construct. | ||
However, it should be noted that the experiment could only be carried out once due to time constraints. | However, it should be noted that the experiment could only be carried out once due to time constraints. | ||
Latest revision as of 21:48, 1 October 2024
4xMREa-EGFP
Usage and Biology
The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.
To increase the efficiency of the activated MTF-1-responsive promoter, we constructed a synthetic promoter with multiple MREa sites. Searle and colleagues described in 1985 that at least two MREa sites are necessary for the zinc-induced expression of the downstream gene, here herpes simplex virus thymidine kinase. They also showed that the positioning of the MREs in the promoter sequence had little effect on the promoter efficiency, but was increased with more MREa sites inserted. Therefore, we put a promoter together with four MREa sites positioned at the sites of the MREwt promoter (K5317003).
Cloning
Theoretical Part Design
Placing the 4xMREa-containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Cloning
The promoter was synthesized and inserted by NEB HiFi DNA Assembly into the pEGFP-C2 backbone plasmid (K3338020) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette. The assembled plasmid is shown in figure 1.
| Primer name | Sequence |
|---|---|
| 4xMREa_fw | CCGCCATGCATTAGTTATGCACACTGGCGCT |
| 4xMREa_rev | TGGCGACCGGTAGCGGACGCTTAGAGGACAGC |
Figure 1: Assembled vector map with 4xMREa-EGFP integrated into the pEGFP-C2 backbone.
Characterization
Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity, and specificity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.
Single-transfection experiments
Figure 2: Single-transfected HEK293T cells with the 4xMREa-EGFP-C2 plasmid depicted no EGFP-signal under unstimulated conditions. Scale bar = 20 µm.
The single transfection with the 4xMREa-EGFP-C2 plasmid in HEK293T cells showed no baseline signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about the sensitivity and specificity of the promoter under homeostatic conditions. Therefore, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditions.
Co-transfection experiments with MTF-1
To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to the second induced plasmid, carrying the 4xMREa promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double-transfection of as many cells as possible, in addition to the non- or only 4xMREa-EGFP-C2- or only MTF1-mRuby2-C2- transfected cells, is crucial for sensor functionality. Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signals intracellularly. The mRuby2 signal, which reflects the localization of MTF-1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected.
Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF1-mRuby2-C2 together with 4xMREa-EGFP-C2. MTF-1 depicts a nuclei-localized signal, the EGFP signal is cytoplasmatic. Shown are brightfield channels (left), fluorescence channels (images in the center), and an overlay of the channels (right).
A basal expression of the promoter-driven reporter fluorophore EGFP can be seen without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.
FACS analysis
FACS analysis enables the quantification of fluorescence signals, which is why they were used here to evaluate the increase in EGFP signal in MTF1-mRuby2-C2 and 4xMREa-EGFP-C2 double-transfected cells depending on the copper sulphate concentration added to the medium for four hours. The results are presented in the bar chart in figure 4.
Figure 4: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the 4xMREa promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated based on their mRuby2-positivity. n=1.
Although not continuous, a clear increase in the number of EGFP-expressing cells can be recognized with increasing copper sulphate concentration in the medium. Growing from approx. 14 % to approx. 21 % of EGFP-positive cells under stimulation with 0 µM or 500 µM CuSO4, respectively. Even if complicated by high basal activity, the presence of copper sulphate can be detected with the 4xMREa promoter construct. However, it should be noted that the experiment could only be carried out once due to time constraints.
Reference
Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985