Difference between revisions of "Part:BBa K5317008"

 
 
(37 intermediate revisions by 3 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K5317008 short</partinfo>
 
<partinfo>BBa_K5317008 short</partinfo>
  
−
The MRE-sites containing promoter enables the metal-dependent expression of a downstream positioned reporter gene via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.
+
===Usage and Biology===
  
 +
The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter gene EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.
  
−
The varying Metal Responsive Elements (MREs) upstream of the eukaryotic metallothionein (MT) gene were discovered in the early 80s (Carter ''et al.'' 1984, Stuart ''et al.'' 1985). All MREs a-d carry core consensus sites (TGCRCNC) to which the primary MRE-binding transcription factor MTF-1 can bind after binding to heavy metal ions and translocating into the nucleus (Wang ''et al.'' 2004). Physiologically, this leads to the expression of metallothionein, a protein capable of binding metals such as zinc, cadmium, copper and others for metal homeostasis and detoxification (Cousins 1983). The arrangement of the MREs in our promoter construct was inspired by publications from Glanville ''et al.'' (1981) and Searle ''et al.'' (1985), maintaining the order of MREs from the physiological murine MT-1 promoter.
 
  
 +
The varying Metal Responsive Elements (MREs) upstream of the eukaryotic metallothionein (MT) gene were discovered in the early 80s (Carter ''et al.'', 1984; Stuart ''et al.'', 1985). All MREs a-d carry core consensus sites (TGCRCNC) to which the primary MRE-binding transcription factor MTF-1 can bind after binding to heavy metal ions and translocating into the nucleus (Wang ''et al.'', 2004). Physiologically, this leads to the expression of metallothionein, a protein capable of binding metals such as zinc, cadmium, copper, and others for metal homeostasis and detoxification (Cousins 1983). The arrangement of the MREs in our promoter construct was inspired by publications from Glanville ''et al.'' (1981) and Searle ''et al.'' (1985), maintaining the order of MREs from the physiological murine MT promoter.
  
−
<!-- Add more about the biology of this part here
+
=Cloning=
−
===Usage and Biology===
+
  
−
<!-- -->
+
===Theoretical Part Design===
−
<span class='h3bb'>Sequence and Features</span>
+
 
 +
Placing the MRE-containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.
 +
 
 +
===Sequence and Features===
 
<partinfo>BBa_K5317008 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5317008 SequenceAndFeatures</partinfo>
  
 +
===Cloning===
 +
 +
The promoter was synthesized, amplified by PCR with the primers listed in table 1, and inserted by NEB HiFi Assembly into the pEGFP-C2 backbone plasmid (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338020 K3338020]</span>) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette.
 +
 +
<html>
 +
 +
 +
 +
  <head>
 +
 +
      <title>HTML Table Caption</title>
 +
 +
  </head>
 +
 +
 +
 +
<body>
 +
 +
<caption>Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone</caption>
 +
 +
<table style="width:70%">
 +
 +
  <tr>
 +
 +
    <th>Primer name</th>
 +
 +
    <th>Sequence</th>
 +
 +
  </tr>
 +
 +
  <tr>
 +
 +
    <td>MREwt_fw</td>
 +
 +
    <td>CCGCCATGCATTAGTTATGCACACTGGCGCT</td>
 +
 +
  </tr>
 +
 +
  <tr>
 +
 +
    <td>MREwt_rev</td>
 +
 +
    <td>TGGCGACCGGTAGCGGACGCTTAGAGGACAGC</td>
 +
 +
  </tr>
 +
 +
</table>
 +
 +
</body>
 +
 +
 +
 +
 +
</html>
 +
 +
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/registry/p-m-mrewt-egfp-neor-c2-map.png" style="width: 50%; height: 50%">
 +
</p>
 +
</center>
 +
</html>
 +
 +
Figure 1: The vector map of the assembled construct of MREwt inserted into the EGFP-C2 backbone.
 +
 +
=Characterization=
 +
 +
Transfection experiments in mammalian HEK293T cells assessed the promoter functionality and sensitivity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part <span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317012 K5317012]</span>) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.
 +
 +
===Single-transfection experiments===
 +
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/registry/5317008-onlymrewt-egfpabf-20um-unstim.png" style="width: 70%; height: 70%">
 +
</p>
 +
</center>
 +
</html>
 +
 +
 +
Figure 2: With the MREwt-EGFP-C2 single-transfected HEK293T cells showed no EGFP signal under unstimulated conditions. Scale bar = 20 µm.
 +
 +
The single transfection with the MREwt-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about the sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditions.
 +
 +
===Co-transfection experiments with MTF-1===
 +
 +
To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to the second induced plasmid, carrying the MREwt promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double transfection of as many cells as possible, in addition to the non- or only MREwt-EGFP- or only MTF1-mRuby2- transfected cells, is crucial for sensor functionality.
 +
Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signaling intracellularly. The mRuby2 signal, which reflects the localization of MTF1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected.
 +
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/registry/k5317008-co-expression.png" style="width: 100%; height: 100%">
 +
</p>
 +
</center>
 +
</html>
 +
 +
Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 together with the MREwt-EGFP-C2 plasmid under homeostatic conditions. The mRuby2 signal from MTF-1 is localized in the nucleus while the EGFP signal is cytoplasmically distributed. Shown are brightfield channels (left), fluorescence channels (images in the center), and an overlay of the channels (right). Scale bar = 20 µm.
 +
 +
A basal expression of the promoter-driven reporter fluorophore EGFP can be seen without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.
 +
 +
====CuSO<sub>4</sub> stimulation====
 +
 +
With MREwt-EGFP-C2 and MTF1-mRuby2-C2 double transfected HEK293T cells were exposed to 500 µM CuSO<sub>4</sub> for four hours in order to test the responsiveness of the sensor to metal ions.
 +
 +
The representative cells in figure 4 again showed a nuclear-localized MTF1-mRuby2 signal and a nucleocytoplasmic EGFP signal, both with and without copper sulfate stimulation.
 +
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/registry/k5317008-cuso4stimulation.png" style="width: 50%; height: 50%">
 +
</p>
 +
</center>
 +
</html>
 +
 +
Figure 4: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2 and the MREwt-EGFP-C2 plasmid before (left column) and after (right column) stimulation with 500 µM CuSO<sub>4</sub> for four hours. Scale bar = 20 µm.
 +
 +
Unfortunately, no clear visual increase in fluorescence was detected for these promoters compared to the baseline signal. However, it is important to note that only small sample sections are presented here, and transfection efficiency may vary between treatments. Visual assessment of fluorescence changes is challenging, which is why flow cell cytometry was subsequently considered to obtain a quantitative analysis.
 +
 +
====FACS analysis====
 +
 +
FACS analysis enables the quantification of fluorescence signals, which is why they were used here to evaluate the increase in EGFP-expressing cells in MTF1-mRuby2-C2 and MREwt-EGFP-C2 double-transfected cells depending on the copper sulphate concentration added to the medium for four hours. The results are presented in the bar chart in figure 5.
 +
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/registry/k5317008-quantification.png" style="width: 60%; height: 60%">
 +
</p>
 +
</center>
 +
</html>
 +
 +
Figure 5: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the MREwt promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated based on their mRuby2-positivity. n=1.
 +
 +
Considering that the experiment was only conducted once, it is evident that no significant increase in the EGFP-positive cells was associated with an increase in the copper sulfate concentration. The MREwt promoter might not be sensitive enough towards the here used copper sulfate concentrations or an increase in activity is overshadowed by the already high basal activity.
 +
 +
=References=
 +
 +
Carter, A. D., Felber, B. K., Walling, M. J., Jubier, M. F., Schmidt, C. J., & Hamer, D. H. (1984). Duplicated heavy metal control sequences of the mouse metallothionein-I gene. Proceedings of the National Academy of Sciences of the United States of America, 81(23), 7392–7396. https://doi.org/10.1073/pnas.81.23.7392
 +
 +
Cousins R. J. (1983). Metallothionein--aspects related to copper and zinc metabolism. Journal of inherited metabolic disease, 6 Suppl 1, 15–21. https://doi.org/10.1007/BF01811318
 +
 +
Glanville, N., Durnam, D. M., & Palmiter, R. D. (1981). Structure of mouse metallothionein-I gene and its mRNA. Nature, 292(5820), 267–269. https://doi.org/10.1038/292267a0
 +
 +
Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985
 +
 +
Stuart, G. W., Searle, P. F., & Palmiter, R. D. (1985). Identification of multiple metal regulatory elements in mouse metallothionein-I promoter by assaying synthetic sequences. Nature, 317(6040), 828–831. https://doi.org/10.1038/317828a0#
 +
 +
Wang, Y., Lorenzi, I., Georgiev, O., & Schaffner, W. (2004). Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration. Biological chemistry, 385(7), 623–632. https://doi.org/10.1515/BC.2004.077
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Latest revision as of 21:43, 1 October 2024


MREwt promoter-EGFP

Usage and Biology

The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter gene EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.


The varying Metal Responsive Elements (MREs) upstream of the eukaryotic metallothionein (MT) gene were discovered in the early 80s (Carter et al., 1984; Stuart et al., 1985). All MREs a-d carry core consensus sites (TGCRCNC) to which the primary MRE-binding transcription factor MTF-1 can bind after binding to heavy metal ions and translocating into the nucleus (Wang et al., 2004). Physiologically, this leads to the expression of metallothionein, a protein capable of binding metals such as zinc, cadmium, copper, and others for metal homeostasis and detoxification (Cousins 1983). The arrangement of the MREs in our promoter construct was inspired by publications from Glanville et al. (1981) and Searle et al. (1985), maintaining the order of MREs from the physiological murine MT promoter.

Cloning

Theoretical Part Design

Placing the MRE-containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Cloning

The promoter was synthesized, amplified by PCR with the primers listed in table 1, and inserted by NEB HiFi Assembly into the pEGFP-C2 backbone plasmid (K3338020) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette.

HTML Table Caption Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone

Primer name Sequence
MREwt_fw CCGCCATGCATTAGTTATGCACACTGGCGCT
MREwt_rev TGGCGACCGGTAGCGGACGCTTAGAGGACAGC


Figure 1: The vector map of the assembled construct of MREwt inserted into the EGFP-C2 backbone.

Characterization

Transfection experiments in mammalian HEK293T cells assessed the promoter functionality and sensitivity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.

Single-transfection experiments


Figure 2: With the MREwt-EGFP-C2 single-transfected HEK293T cells showed no EGFP signal under unstimulated conditions. Scale bar = 20 µm.

The single transfection with the MREwt-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about the sensitivity and specificity of the promoter under homeostatic conditions. In conclusion, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditions.

Co-transfection experiments with MTF-1

To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to the second induced plasmid, carrying the MREwt promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double transfection of as many cells as possible, in addition to the non- or only MREwt-EGFP- or only MTF1-mRuby2- transfected cells, is crucial for sensor functionality. Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signaling intracellularly. The mRuby2 signal, which reflects the localization of MTF1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected.

Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 together with the MREwt-EGFP-C2 plasmid under homeostatic conditions. The mRuby2 signal from MTF-1 is localized in the nucleus while the EGFP signal is cytoplasmically distributed. Shown are brightfield channels (left), fluorescence channels (images in the center), and an overlay of the channels (right). Scale bar = 20 µm.

A basal expression of the promoter-driven reporter fluorophore EGFP can be seen without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.

CuSO4 stimulation

With MREwt-EGFP-C2 and MTF1-mRuby2-C2 double transfected HEK293T cells were exposed to 500 µM CuSO4 for four hours in order to test the responsiveness of the sensor to metal ions.

The representative cells in figure 4 again showed a nuclear-localized MTF1-mRuby2 signal and a nucleocytoplasmic EGFP signal, both with and without copper sulfate stimulation.

Figure 4: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2 and the MREwt-EGFP-C2 plasmid before (left column) and after (right column) stimulation with 500 µM CuSO4 for four hours. Scale bar = 20 µm.

Unfortunately, no clear visual increase in fluorescence was detected for these promoters compared to the baseline signal. However, it is important to note that only small sample sections are presented here, and transfection efficiency may vary between treatments. Visual assessment of fluorescence changes is challenging, which is why flow cell cytometry was subsequently considered to obtain a quantitative analysis.

FACS analysis

FACS analysis enables the quantification of fluorescence signals, which is why they were used here to evaluate the increase in EGFP-expressing cells in MTF1-mRuby2-C2 and MREwt-EGFP-C2 double-transfected cells depending on the copper sulphate concentration added to the medium for four hours. The results are presented in the bar chart in figure 5.

Figure 5: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the MREwt promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated based on their mRuby2-positivity. n=1.

Considering that the experiment was only conducted once, it is evident that no significant increase in the EGFP-positive cells was associated with an increase in the copper sulfate concentration. The MREwt promoter might not be sensitive enough towards the here used copper sulfate concentrations or an increase in activity is overshadowed by the already high basal activity.

References

Carter, A. D., Felber, B. K., Walling, M. J., Jubier, M. F., Schmidt, C. J., & Hamer, D. H. (1984). Duplicated heavy metal control sequences of the mouse metallothionein-I gene. Proceedings of the National Academy of Sciences of the United States of America, 81(23), 7392–7396. https://doi.org/10.1073/pnas.81.23.7392

Cousins R. J. (1983). Metallothionein--aspects related to copper and zinc metabolism. Journal of inherited metabolic disease, 6 Suppl 1, 15–21. https://doi.org/10.1007/BF01811318

Glanville, N., Durnam, D. M., & Palmiter, R. D. (1981). Structure of mouse metallothionein-I gene and its mRNA. Nature, 292(5820), 267–269. https://doi.org/10.1038/292267a0

Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985

Stuart, G. W., Searle, P. F., & Palmiter, R. D. (1985). Identification of multiple metal regulatory elements in mouse metallothionein-I promoter by assaying synthetic sequences. Nature, 317(6040), 828–831. https://doi.org/10.1038/317828a0#

Wang, Y., Lorenzi, I., Georgiev, O., & Schaffner, W. (2004). Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration. Biological chemistry, 385(7), 623–632. https://doi.org/10.1515/BC.2004.077