Difference between revisions of "Part:BBa K5143003"

 
(2 intermediate revisions by one other user not shown)
Line 10: Line 10:
 
         Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of Cp19k-MaSp1 was higher than that of individual proteins. Adhesion strength: 39.9.7 mJ/m²
 
         Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of Cp19k-MaSp1 was higher than that of individual proteins. Adhesion strength: 39.9.7 mJ/m²
 
     </p>
 
     </p>
 +
<br>
 
     <img src="https://static.igem.wiki/teams/5143/cp19k-masp1-bba-k5143003.png" width="400" alt="Cp19k-MaSp1">
 
     <img src="https://static.igem.wiki/teams/5143/cp19k-masp1-bba-k5143003.png" width="400" alt="Cp19k-MaSp1">
 +
<br>
 +
<br>
 
     <h1>Construction</h1>
 
     <h1>Construction</h1>
 
     <p>
 
     <p>
 
         The codons were optimised for synthesis and expression in <I> Saccharomyces cerevisiae </I>. <br>
 
         The codons were optimised for synthesis and expression in <I> Saccharomyces cerevisiae </I>. <br>
         MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT <br>
+
         MaSp1 and Cp19k are fused with the GS linker. <br>
 
         This composite part is part of the following larger composite part: <a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a> <br>
 
         This composite part is part of the following larger composite part: <a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a> <br>
 
         It was synthesized in its entirety and then cloned via PCR into the following plasmid: <a href="https://parts.igem.org/Part:BBa_K5143005" target="_blank">BBa_K5143005</a>
 
         It was synthesized in its entirety and then cloned via PCR into the following plasmid: <a href="https://parts.igem.org/Part:BBa_K5143005" target="_blank">BBa_K5143005</a>
 
     </p>
 
     </p>
    <h1>References</h1>
+
 
    <p>
+
        Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: <a href="https://doi.org/10.1016/j.ijbiomac.2023.127125" target="_blank">10.1016/j.ijbiomac.2023.127125</a>. Epub 2023 Sep 28. PMID: 37776922.
+
    </p>
+
 
</body>
 
</body>
 
</html>
 
</html>
Line 30: Line 30:
 
<h1>Sequence and Features</h1>
 
<h1>Sequence and Features</h1>
 
<partinfo>BBa_K5143003 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5143003 SequenceAndFeatures</partinfo>
 +
<br>
 +
<html>
 +
<body>
 +
<h1>References</h1>
 +
    <p>
 +
        1. Ye, L. et al. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol 253, 127125 (2023).
  
 
+
    </p>
 +
</body>
 +
</html>
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K5143003 parameters</partinfo>
 
<partinfo>BBa_K5143003 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 14:49, 1 October 2024

Protein Description

Description

Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of Cp19k-MaSp1 was higher than that of individual proteins. Adhesion strength: 39.9.7 mJ/m²


Cp19k-MaSp1

Construction

The codons were optimised for synthesis and expression in Saccharomyces cerevisiae .
MaSp1 and Cp19k are fused with the GS linker.
This composite part is part of the following larger composite part: BBa_K5143024
It was synthesized in its entirety and then cloned via PCR into the following plasmid: BBa_K5143005

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 746
    Illegal PstI site found at 1049
    Illegal PstI site found at 1142
    Illegal PstI site found at 1148
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 746
    Illegal PstI site found at 1049
    Illegal PstI site found at 1142
    Illegal PstI site found at 1148
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 577
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 746
    Illegal PstI site found at 1049
    Illegal PstI site found at 1142
    Illegal PstI site found at 1148
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 746
    Illegal PstI site found at 1049
    Illegal PstI site found at 1142
    Illegal PstI site found at 1148
  • 1000
    COMPATIBLE WITH RFC[1000]


References

1. Ye, L. et al. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol 253, 127125 (2023).