Difference between revisions of "Part:BBa K5317019"

(Sequence and Features)
(Cloning)
Line 15: Line 15:
  
 
===Cloning===
 
===Cloning===
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI and inserted the both genes ccpA(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K33380014]</span>) and mRuby2(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>), which were fused bevorhand together with matching overhangs. The ccpA gene was acquired from ''S. aureus''. Following the NEBBuilder® user protocol this vector was cloned via HIFI assembly method.This composite part was cloned by using the primers in table 1.
+
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI, providing a CMV promoter, and inserted the genes CcpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K33380014]</span>) and mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>) downstream, generation a fusionprotein. The correct order in the plasmid of CcpA and mRuby2 was guided by approx. 20 bp long overhangs at each 5' and 3' and of the amplicon, following the NEBBuilder® HIFI user protocol.This composite part was cloned by using the primers in table 1.
  
 
<html>  
 
<html>  

Revision as of 14:20, 1 October 2024

CMV-CcpA-mRuby2


Usage and Biology

The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to our specifically engineered promoter 3xCre3xAP1-miniCMV (K5317017). We therefore fused an mRuby2 marker gene (K5317001) to detect localization of ccpA protein in HEK292T cells.

Theoretical Part Design

CcpA was codon-optimized for the expression in mammalian systems and synthesized with the coorect approx. 20 bp overhangs for introduction into a backbone plasmid. Placing the ccpA (K3338014) upstream of the reporter gene mRuby2 (K5317001) allows for visualisation of expression and localization of CcpA.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 1669

Cloning

We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI, providing a CMV promoter, and inserted the genes CcpA (K33380014) and mRuby2 (K3338001) downstream, generation a fusionprotein. The correct order in the plasmid of CcpA and mRuby2 was guided by approx. 20 bp long overhangs at each 5' and 3' and of the amplicon, following the NEBBuilder® HIFI user protocol.This composite part was cloned by using the primers in table 1.

HTML Table Caption Table1: Primers used to extract and clone the ccpA gene sequence.

Primer name Sequence
ccpA_fw_1 tggatccccttttgtagttcctcggtattcaattctgtgag
ccpA_rv_2 TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc
ccpA_fw_3 actacaaaaggggatccaccggtcg
ccpA_rv_4 TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc

Characterisation

Transfection experiments of CcpA in mammalian HEK cells to show localisation and activation of CcpA in unstimulated conditions. This is was one of three possible transcription factors we analysed within this project. However, this protein was unable to be expressed in HEK cells and was not further investigated.

Single-transfection experiments

Figure 2: Depicted HEK cells transfected with CMV-ccpA-mRuby2 containing plasmid. Scaling (bottom right) is 10 µM.

In Figure 2 are transfected CMV-ccpA-mRuby2-HEK cells shown. CcpA did show any fluorescent signal and did not lead to any further investigations.

References

Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. Journal of Bacteriology, 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21

Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. Journal of Biological Chemistry, 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587