Difference between revisions of "Part:BBa K5201000"
Line 1: | Line 1: | ||
+ | ==Characterisation of BBa_K5201001: HongKong-UCCKE== | ||
+ | <html> | ||
+ | <body> | ||
+ | |||
<table> | <table> | ||
<tr> | <tr> | ||
Line 137: | Line 141: | ||
</tr> | </tr> | ||
</table> | </table> | ||
+ | |||
+ | |||
+ | </body> | ||
+ | </html> |
Revision as of 14:04, 1 October 2024
Characterisation of BBa_K5201001: HongKong-UCCKE
Part registry |
BBa_K5201000 |
|||||||||||
Part type |
Coding sequence |
|||||||||||
Short description |
pmHAS*1-703 is a gene from Pasteurella Multocida, optimized for expression of class II hyaluronic acid synthase (HAS) in E. coli |
|||||||||||
Long description |
Biology pmHAS encodes hyaluronan synthase (HAS) from Pasteurella Multocida. pmHAS is a class II HAS enzyme, which is a peripheral membrane protein that can function without cell membrane. Usage and design Our recombinant plasmid consists of pmHAS and kfiD which is expressed under promoter (BBa_R0010). We hope that the pmHAS can produce HAS enzyme for synthesis of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use. Standard curve of HA The cetyltrimethylammonium bromide (CTAB) solution will react with HA to form precipitate, which absorbs 400 nm light. 150µL of standard HA solution in range of 0g/L to 0.1g/L, 350µL acetate acid, 1mL of 2.5g/L CTAB solution at room temperature for 5 min is added in a 96-well plate. The absorbance of the precipitate at 400 nm is measured using a plate reader. The standard curve of OD400 against HA concentration is plotted.
Production of HA
We expressed pmHAS in DH5a E. coli under a lac promoter and measured the amount of HA produced. In both glucose medium and glucose + glucosamine medium, we observed a consistent increase in HA absorbance suggesting that the HAS is functional and able to synthesize HA in E. coli. We also observed that the addition of glucosamine, one of the precursors of HA, can further increase the HA yield. |
|||||||||||
Source |
Pasteurella Multocida |
|||||||||||
Design considerations |
To facilitate cell-free systems in the future, the pmHAS gene is designed to produce residues 1-703 which are used to produce HAS. The residues 704-972 are used to connect to the cell membrane. This truncated form allows HAS to be produced without attaching to the cell membranes. |
|||||||||||
Sequence |
gaattcgcggccgcttctagagatgcatcaccatcatcaccacaataccctgagtcaggccattaaggcctataatagcaatgattatcagctcgcattaaaattatttgaaaaaagcgcggagatttatggtcgtaaaatcgttgaatttcagatcacgaaatgcaaagaaaagctgagcgcgcatccgtcggtaaattctgcgcatttaagtgtgaacaaggaagaaaaagtgaatgtctgcgattcccctctcgatattgccactcagctgttgctgtcgaacgttaaaaaattggtcctttcagattcagaaaaaaataccttaaaaaataaatggaaattgctgacggagaaaaaaagcgagaatgctgaagtgcgcgctgtggccctggtgccgaaagacttcccgaaagacctggtgctggcgcctctacctgatcatgtgaacgattttacatggtacaaaaaacgtaagaagcgcctgggaatcaagcctgaacaccaacacgtcggactgtccattatcgtgaccaccttcaaccgcccggcgattttatccattaccttggcgtgtttagttaaccagaaaacgcactatccgtttgaggtcatcgtgaccgatgatggcagccaggaagacttgagcccgattatccgccaatatgaaaataaattagacatacgctacgtacgtcagaaagataacggctttcaagcatcggcggcacgaaacatggggctgcggctagccaaatatgactttattggcctgctggactgtgatatggcgcccaacccgctgtgggtccattcttatgtagccgagctgctggaagatgatgatctgaccattattgggccgcgtaaatacatagatacccagcacattgatccgaaagattttttaaataacgcgtcgttactggagagccttcctgaagttaagactaataactctgtcgcggccaaaggggaaggtacggttagtctggattggaggcttgaacagttcgaaaaaacagaaaatctgcgtctcagcgactccccctttcgcttctttgcagccggtaacgttgccttcgcgaaaaagtggctgaataaaagtggcttcttcgatgaagagttcaaccattggggcggtgaagatgttgaatttgggtaccgtctcttccggtatggcagctttttcaaaaccatcgacggcatcatggcgtatcaccaggagcccccaggcaaggagaacgagaccgatcgcgaagcgggcaaaaatattacgcttgatatcatgcgtgaaaaagttccatacatttatcgaaagctgctgccgattgaagacagccacattaatcgcgtgccgctggtgtcgatttacattccggcgtacaactgtgcgaattatatccaacgttgcgttgattcagcgttgaaccaaaccgtagtcgacctggaagtgtgcatctgtaatgatggtagtactgataatacattagaggtaatcaacaaactgtatggaaacaacccgcgtgtgcgcattatgtcgaaaccaaacggcggcattgcatctgcgagcaacgctgccgtgtcgtttgccaagggctactatattggccagctggacagtgacgactacttggaaccggatgccgtggaactatgcctgaaggaatttctgaaagataagacgctggcatgcgtgtacaccaccaaccgcaatgtaaatccagacggcagcctcattgcaaatggctacaattggccggaatttagccgcgaaaaactcacaactgcaatgatcgctcatcattttcgtatgttcactattcgcgcttggcacttgacggacggtttcaatgaaaaaatagaaaacgcagttgactacgatatgttccttaaactttcagaggtcggaaaatttaagcatctgaacaaaatctgttacaatcgcgttcttcacggtgataacacgtcaatcaaaaaactaggtattcagaaaaaaaaccattttgtggtagtgaatcaaagcctgaaccgtcagggtatcacctattacaactatgatgaatttgatgatcttgatgagtcaagaaagtacattttcaacaaaaccgccgagtatcaggaagaaattgatattctcaaggacatttactagtagcggccgctgcag |
|||||||||||
Assembly compatibility |
RFC10 |
|||||||||||
Reference |
Sze, J. H., Brownlie, J. C., & Love, C. A. (2016). Biotechnological production of hyaluronic acid: a mini review. 3 Biotech, 6(1), 67. https://doi.org/10.1007/s13205-016-0379-9 |