Difference between revisions of "Part:BBa K5384004"

 
(4 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K5384004 short</partinfo>
 
<partinfo>BBa_K5384004 short</partinfo>
  
The Pichia pastoris alcohol oxidase 1 (AOX1) promoter variant is characterized by comprising at least one of the specified modifications in the wild-type Pichia pastoris AOX1 promoter of SEQ ID NO: 1. a) Nucleotides 94-110 (-847-831), Nucleotides 141-160 (-800--781), Nucleotides 312-330 (-629-6-111), Nucleotides 355-380 (-586-561), Nucleotides 501-521 (-440-420); inside nucleotides 640-658 (-301--283), nucleotides 674-693 (-267--248) and nucleotides 1-840 (-940--100). Integration of the Cat8 transcription factor binding site (TFBS) at any position, in particular the integration of the "TTCCGTTCGTCCGA" gene sequence or other gene sequence showing at least 80&#65285; similarity to this sequence; b) Nucleotides 1-840 (-). Integration of Aca1 or Aca2 TFBS at any position between 940--100), particularly integration of the "GCCATTTGTAGACGTCAACCC" nucleotide sequence or other gene sequence showing at least 80&#65285; similarity to this sequence; c) Nucleotide 94 Within ~ 693 (-847 to -248), the mutation specified by SEQ ID NO: 2 as well as the mutation selected from the group consisting of combinations thereof are included, and the AOX1 promoter variant further comprises the wild-type AOX1 promoter described above. When compared to, it is characterized by its increased strength and guiding ability.[1,2]
+
The Pichia pastoris alcohol oxidase 1 (AOX 1) promoter variant is characterized by comprising at least one of the specified modifications in the wild-type Pichia pastoris AOX 1 promoter of SEQ ID NO: 1. a) Nucleotides 94-110 (-847-831), nucleotides 141-160 (-800--781), nucleotides 312-330 (-629-6-111), nucleotides 355-380 (-586-561), nucleotides 501-521 (-440-420); inside nucleotides 640-658 (-301--283), nucleotides 674-693 (-267--248) and nucleotides 1-840 (-940--100). Integration of the Cat8 transcription factor binding site (TFBS) at any position, in particular the integration of the "TTCCGTTCGTCCGA" gene sequence or other gene sequence showing at least 80&#65285; similarity to this sequence; b) Nucleotides 1-840 (-). Integration of Aca1 or Aca2 TFBS at any position between 940--100), particularly integration of the "GCCATTTGTAGACGTCAACCC" nucleotide sequence or other gene sequence showing at least 80&#65285; similarity to this sequence; c) Nucleotide 94 Within ~ 693 (-847 to -248), the mutation specified by SEQ ID NO: 2 as well as the mutation selected from the group consisting of combinations thereof are included, and the AOX1 promoter variant further comprises the wild-type AOX 1 promoter described above. When compared to, it is characterized by its increased strength and guiding ability.[1,2]
 +
 
  
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the plasmids.[3,4]
+
We show that the AOX 1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the plasmids.[3,4]
 
<!-- -->
 
<!-- -->
 
===Sequence and Features===
 
===Sequence and Features===
Line 19: Line 19:
  
 
===References===
 
===References===
[1]PORTELA RUI M. C., VOGL THOMAS, EBNER KATHARINA, et al. Pichia pastoris Alcohol Oxidase 1Pichia pastoris Alcohol Oxidase 1(AOX1) Core Promoter Engineering by High Resolution Systematic Mutagenesis[J]. Biotechnology Journal:Healthcare,Nutrition,Technology,2018,13(3):1700340-1-1700340-8.  
+
[1] PORTELA RUI M. C., VOGL THOMAS, EBNER KATHARINA, et al. Pichia pastoris Alcohol Oxidase 1Pichia pastoris Alcohol Oxidase 1(AOX1) Core Promoter Engineering by High Resolution Systematic Mutagenesis[J]. Biotechnology Journal:Healthcare,Nutrition,Technology,2018,13(3):1700340-1-1700340-8.  
  
[2]XIONG Xianghua, ZHAO Hongliang, XUE Chong, et al. Isolation and Identification of Pichia Alcohol Oxidase 1 Promoter Mutants[J]. Biotechnology Letters,2008,19(1):11-13.] DOI:10.3969/j.issn.1009-0002.2008.01.004.
+
[2] XIONG Xianghua, ZHAO Hongliang, XUE Chong, et al. Isolation and Identification of Pichia Alcohol Oxidase 1 Promoter Mutants[J]. Biotechnology Letters,2008,19(1):11-13.] DOI:10.3969/j.issn.1009-0002.2008.01.004.
  
[3]BAURAIN D, DINANT M, COOSEMANS N, et al. Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter[J]. Plant physiology,2003,131(3):1418-1430.
+
[3] BAURAIN D, DINANT M, COOSEMANS N, et al. Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter[J]. Plant physiology,2003,131(3):1418-1430.
  
[4]WANG, XIAOLONG, CAI, MENGHAO, SHI, LEI, et al. PpNrg1 is a transcriptional repressor for glucose and glycerol repression of AOX1 promoter in methylotrophic yeast Pichia pastoris[J]. Biotechnology Letters,2016,38(2):291-298. DOI:10.1007/s10529-015-1972-4.
+
[4] WANG, XIAOLONG, CAI, MENGHAO, SHI, LEI, et al. PpNrg1 is a transcriptional repressor for glucose and glycerol repression of AOX1 promoter in methylotrophic yeast Pichia pastoris[J]. Biotechnology Letters,2016,38(2):291-298. DOI:10.1007/s10529-015-1972-4.

Latest revision as of 14:03, 1 October 2024


AOX 1 promoter

The Pichia pastoris alcohol oxidase 1 (AOX 1) promoter variant is characterized by comprising at least one of the specified modifications in the wild-type Pichia pastoris AOX 1 promoter of SEQ ID NO: 1. a) Nucleotides 94-110 (-847-831), nucleotides 141-160 (-800--781), nucleotides 312-330 (-629-6-111), nucleotides 355-380 (-586-561), nucleotides 501-521 (-440-420); inside nucleotides 640-658 (-301--283), nucleotides 674-693 (-267--248) and nucleotides 1-840 (-940--100). Integration of the Cat8 transcription factor binding site (TFBS) at any position, in particular the integration of the "TTCCGTTCGTCCGA" gene sequence or other gene sequence showing at least 80% similarity to this sequence; b) Nucleotides 1-840 (-). Integration of Aca1 or Aca2 TFBS at any position between 940--100), particularly integration of the "GCCATTTGTAGACGTCAACCC" nucleotide sequence or other gene sequence showing at least 80% similarity to this sequence; c) Nucleotide 94 Within ~ 693 (-847 to -248), the mutation specified by SEQ ID NO: 2 as well as the mutation selected from the group consisting of combinations thereof are included, and the AOX1 promoter variant further comprises the wild-type AOX 1 promoter described above. When compared to, it is characterized by its increased strength and guiding ability.[1,2]


Usage and Biology

We show that the AOX 1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the plasmids.[3,4]

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


References

[1] PORTELA RUI M. C., VOGL THOMAS, EBNER KATHARINA, et al. Pichia pastoris Alcohol Oxidase 1Pichia pastoris Alcohol Oxidase 1(AOX1) Core Promoter Engineering by High Resolution Systematic Mutagenesis[J]. Biotechnology Journal:Healthcare,Nutrition,Technology,2018,13(3):1700340-1-1700340-8.

[2] XIONG Xianghua, ZHAO Hongliang, XUE Chong, et al. Isolation and Identification of Pichia Alcohol Oxidase 1 Promoter Mutants[J]. Biotechnology Letters,2008,19(1):11-13.] DOI:10.3969/j.issn.1009-0002.2008.01.004.

[3] BAURAIN D, DINANT M, COOSEMANS N, et al. Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter[J]. Plant physiology,2003,131(3):1418-1430.

[4] WANG, XIAOLONG, CAI, MENGHAO, SHI, LEI, et al. PpNrg1 is a transcriptional repressor for glucose and glycerol repression of AOX1 promoter in methylotrophic yeast Pichia pastoris[J]. Biotechnology Letters,2016,38(2):291-298. DOI:10.1007/s10529-015-1972-4.