Difference between revisions of "Part:BBa K206000:Design"
(One intermediate revision by the same user not shown) | |||
Line 25: | Line 25: | ||
</center> | </center> | ||
</div> | </div> | ||
− | + | <br> | |
+ | <br> | ||
<partinfo>BBa_K206000 SequenceAndFeatures</partinfo> | <partinfo>BBa_K206000 SequenceAndFeatures</partinfo> | ||
− | + | <br> | |
− | + | ||
==Design Notes== | ==Design Notes== | ||
− | Niland et al. found that certain mutations in the AraI1 site increased binding of the DNA to the AraC protein. We applied all of these mutations | + | Niland et al. found that certain mutations in the AraI1 operator site increased binding of the DNA to the AraC protein [[Part:BBa_K206000:Design#References|[1]]]. We applied all of these mutations with the goal of creating a stronger version of the pBAD promoter. See [[pBAD Promoter Family]] for more details. |
==Source== | ==Source== | ||
Site-directed mutagenesis was performed on <partinfo>I13453</partinfo> using the following primers:<br> | Site-directed mutagenesis was performed on <partinfo>I13453</partinfo> using the following primers:<br> | ||
− | Forward: TAATCTTATGGACTATCTTGCTATGGCATAGC<br> | + | Forward: 5'-PO4-TAATCTTATGGACTATCTTGCTATGGCATAGC-3'<br> |
− | Reverse: GCGGATCCTACCTGACGCTTTTTATC | + | Reverse: 5'-PO4-GCGGATCCTACCTGACGCTTTTTATC-3' |
+ | |||
+ | ''Site-directed mutagenesis:'' We used the Finnzyme Phusion Site-directed Mutagenesis Kit in accordance with the manufacturer's directions. | ||
+ | <br> | ||
+ | ''Primers: ''Phosphorylated oligos were purchased from Integrated DNA Technologies (IDT) and resuspended in water. | ||
+ | <br> | ||
+ | ''Template:'' <partinfo>I13453</partinfo> was obtained from the 2009 iGEM Spring Distribution according to Registry instructions and used as the template for site-directed mutagenesis. | ||
==References== | ==References== | ||
− | Niland P, Hühne R, Müller-Hill B. (1996). How AraC Interacts Specifically with its Target DNAs. | + | [http://www.ncbi.nlm.nih.gov/pubmed/8980677 [1]] Niland P, Hühne R, and Müller-Hill B. (1996). How AraC Interacts Specifically with its Target DNAs. J. Mol. Biol. '''264''':667-674. |
Latest revision as of 23:57, 21 October 2009
Assembly Compatibility:
Design NotesNiland et al. found that certain mutations in the AraI1 operator site increased binding of the DNA to the AraC protein [1]. We applied all of these mutations with the goal of creating a stronger version of the pBAD promoter. See pBAD Promoter Family for more details. SourceSite-directed mutagenesis was performed on BBa_I13453 using the following primers: Site-directed mutagenesis: We used the Finnzyme Phusion Site-directed Mutagenesis Kit in accordance with the manufacturer's directions.
References[http://www.ncbi.nlm.nih.gov/pubmed/8980677 [1]] Niland P, Hühne R, and Müller-Hill B. (1996). How AraC Interacts Specifically with its Target DNAs. J. Mol. Biol. 264:667-674. |