Difference between revisions of "Part:BBa K5267002"

(One intermediate revision by one other user not shown)
Line 2: Line 2:
 
<partinfo>BBa_K5267002 short</partinfo>
 
<partinfo>BBa_K5267002 short</partinfo>
  
GPCRs
+
<p> The mammalian MT2 melatonin receptor is a G protein-coupled receptor (GPCR) primarily coupled to the Gi/o protein family. This receptor plays a crucial role in regulating circadian rhythms and sleep-wake cycles by responding to melatonin, a hormone produced by the pineal gland. The MT2 receptor has a seven-transmembrane domain structure characteristic of GPCRs and is involved in inhibiting adenylate cyclase activity, leading to decreased levels of cAMP. It also participates in other signaling pathways, including the activation of ERK/MAPK pathway. Structural studies of MT2 reveal unique features such as a "lid-like" structure in the extracellular loop 2 (ECL2) that influences ligand binding and selectivity. This part is essential for projects involving the study of circadian biology, sleep regulation, and the pharmacological targeting of melatonin receptors. </p>
 
+
<!-- Add more about the biology of this part here
+
===Usage and Biology===
+
  
 
<!-- -->
 
<!-- -->
<span class='h3bb'>Sequence and Features</span>
+
===Sequence and Features===
 
<partinfo>BBa_K5267002 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5267002 SequenceAndFeatures</partinfo>
  
Line 25: Line 22:
  
 
===Usage and Biology===
 
===Usage and Biology===
MT2(melatonin receptor type 2) is an integral membrane protein that is a G protein coupled receptor (GPCR), 7-transmembrane receptor. It is found primarily in the retina and brain. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin.<sup>[1]</sup>
+
<p> This part of gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor, a rhodopsin-like class A receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is resadily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin.[1] </p>
MT2 has been reported to modulate many physiological processes, especially those related to sleep and circadian rhythm regulation, but also in retina physiology, pain and neuronal and immune functions.
+
 
 +
<p> In the human body, melatonin (N-acetyl-5-methoxytryptamine) is a widespread neurohormone with roles in circadian rhythm regulation, antioxidative protection and several other functions. It binds to the ligand binding pocket of melatonin receptor with high affinity in the human body.[2] </p>
 
<html>
 
<html>
  
Line 32: Line 30:
 
<div style="width=100%;height=auto;align-items:center">
 
<div style="width=100%;height=auto;align-items:center">
 
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/4.jpg" class="figure-img img-fluid rounded"  height="400px">
 
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/4.jpg" class="figure-img img-fluid rounded"  height="400px">
 +
 +
</figure>
  
 
</html>
 
</html>
  
<br>Figure: Overall structures of MT2 (F: inactive state [PDB ID: 6ME6], J: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (G) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (K) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. <sup>[3]</sup>
+
<br>Figure: Overall structures of MT2 (F: inactive state [PDB ID: 6ME6], J: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (G) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (K) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. [3]
  
  
 
===Signal transduction features===
 
===Signal transduction features===
As a class of GPCR, MT2 mainly transmits signals through G protein coupling. MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein by activating Gαi/oA, inhibiting the intracellular AC activity and reducing the intracellular cAMP concentration. MT2 also inhibits the activity of guanylyl cyclase (GC) and reducing the intracellular cGMP concentration, to regulate cGMP-dependent signaling pathways. MT2 can also regulate gene expression by coupling with Gαq/11 protein to activate PLC, increase intracellular Ca2+ level, and activate PKC pathway to promote downstream signal transduction. [2]
+
As a class of GPCR, MT2 mainly transmits signals through G protein coupling. MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein by activating Gαi/oA, inhibiting the intracellular AC activity and reducing the intracellular cAMP concentration. MT2 also inhibits the activity of guanylyl cyclase (GC) and reducing the intracellular cGMP concentration, to regulate cGMP-dependent signaling pathways. MT2 can also regulate gene expression by coupling with Gαq/11 protein to activate PLC, increase intracellular Ca2+ level, and activate PKC pathway to promote downstream signal transduction. [4]
 
<br>In terms of transcriptional regulation, melatonin signaling typically inhibits cAMP-responsive element binding (CREB), which activates gene transcription though the ERK pathway. [3]
 
<br>In terms of transcriptional regulation, melatonin signaling typically inhibits cAMP-responsive element binding (CREB), which activates gene transcription though the ERK pathway. [3]
 
<br>The figure from Okamoto, H. H., Cecon, E., Nureki, O., Rivara, S., & Jockers, R. (2024) shows melatonin receptor-mediated signal transduction. (Fig.1)  
 
<br>The figure from Okamoto, H. H., Cecon, E., Nureki, O., Rivara, S., & Jockers, R. (2024) shows melatonin receptor-mediated signal transduction. (Fig.1)  
Line 47: Line 47:
 
<figure class="figure">
 
<figure class="figure">
 
<div style="width=100%;height=auto">
 
<div style="width=100%;height=auto">
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/5.png" class="figure-img img-fluid rounded"  height="400px">
+
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/5.jpg" class="figure-img img-fluid rounded"  height="350px">
 +
 
 +
</figure>
  
 
</html>
 
</html>
<br>Figure 1. Melatonin receptor signaling pathways. [3]  
+
<br>'''Figure 1. Melatonin receptor signaling pathways. [3]'''  
===Function test===
+
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. '''(Figure 1)'''
+
In Figure 1, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
+
  
  
===Sequence===
+
===Reference===
Top:
+
<p> [1] N. database, "Gene [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2024 Sep 01]. Available from: https://www.ncbi.nlm.nih.gov/gene/," 2004. </p>
<br>GGAGTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTA
+
<br>GCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTAGACTCTAGAGGGTATATAATGGAAGCTCGACTTC
+
<br>CAGTACT
+
  
 +
<p> [2] H. H. Okamoto, E. Cecon, O. Nureki, S. Rivara, and R. Jockers, “Melatonin receptor structure and signaling,” Journal of Pineal Research, vol. 76, no. 3, 2024. </p>
  
===Reference===
+
<p> [3] Y. Gao, S. Zhao, Y. Zhang, and Q. Zhang, “Melatonin Receptors: A Key Mediator in Animal Reproduction,” Vet. Sci., vol. 9, no. 7, p. 309, Jun. 2022, doi: 10.3390/vetsci9070309. </p>
[1] Hawley DK, McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25.
+
 
<br>[2] Rao, A., Luo, C., & Hogan, P.G. (1997). Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 1997.
+
<p> [4] “Melatonin receptor structure and signaling,” J. Pineal Res., vol. 76, no. 3, p. e12952, Apr. 2024, doi: 10.1111/jpi.12952. </p>
<br>[3] Rooney JW, Hodge MR, McCaffrey PG, Rao A, Glimcher LH. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 1994 Feb 1.
+

Revision as of 11:27, 30 September 2024

Mammalian MT2 melatonin receptor

The mammalian MT2 melatonin receptor is a G protein-coupled receptor (GPCR) primarily coupled to the Gi/o protein family. This receptor plays a crucial role in regulating circadian rhythms and sleep-wake cycles by responding to melatonin, a hormone produced by the pineal gland. The MT2 receptor has a seven-transmembrane domain structure characteristic of GPCRs and is involved in inhibiting adenylate cyclase activity, leading to decreased levels of cAMP. It also participates in other signaling pathways, including the activation of ERK/MAPK pathway. Structural studies of MT2 reveal unique features such as a "lid-like" structure in the extracellular loop 2 (ECL2) that influences ligand binding and selectivity. This part is essential for projects involving the study of circadian biology, sleep regulation, and the pharmacological targeting of melatonin receptors.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: MTNR1B
Pairs: 1089bp
Origin: Homo sapiens
Properties: GPCRs


Usage and Biology

This part of gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor, a rhodopsin-like class A receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is resadily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin.[1]

In the human body, melatonin (N-acetyl-5-methoxytryptamine) is a widespread neurohormone with roles in circadian rhythm regulation, antioxidative protection and several other functions. It binds to the ligand binding pocket of melatonin receptor with high affinity in the human body.[2]


Figure: Overall structures of MT2 (F: inactive state [PDB ID: 6ME6], J: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (G) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (K) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. [3]


Signal transduction features

As a class of GPCR, MT2 mainly transmits signals through G protein coupling. MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein by activating Gαi/oA, inhibiting the intracellular AC activity and reducing the intracellular cAMP concentration. MT2 also inhibits the activity of guanylyl cyclase (GC) and reducing the intracellular cGMP concentration, to regulate cGMP-dependent signaling pathways. MT2 can also regulate gene expression by coupling with Gαq/11 protein to activate PLC, increase intracellular Ca2+ level, and activate PKC pathway to promote downstream signal transduction. [4]
In terms of transcriptional regulation, melatonin signaling typically inhibits cAMP-responsive element binding (CREB), which activates gene transcription though the ERK pathway. [3]
The figure from Okamoto, H. H., Cecon, E., Nureki, O., Rivara, S., & Jockers, R. (2024) shows melatonin receptor-mediated signal transduction. (Fig.1)


Figure 1. Melatonin receptor signaling pathways. [3]


Reference

[1] N. database, "Gene [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2024 Sep 01]. Available from: https://www.ncbi.nlm.nih.gov/gene/," 2004.

[2] H. H. Okamoto, E. Cecon, O. Nureki, S. Rivara, and R. Jockers, “Melatonin receptor structure and signaling,” Journal of Pineal Research, vol. 76, no. 3, 2024.

[3] Y. Gao, S. Zhao, Y. Zhang, and Q. Zhang, “Melatonin Receptors: A Key Mediator in Animal Reproduction,” Vet. Sci., vol. 9, no. 7, p. 309, Jun. 2022, doi: 10.3390/vetsci9070309.

[4] “Melatonin receptor structure and signaling,” J. Pineal Res., vol. 76, no. 3, p. e12952, Apr. 2024, doi: 10.1111/jpi.12952.