Difference between revisions of "Part:BBa K5407010"

Latest revision as of 10:29, 30 September 2024

The NLS plasmids

Usage and Biology

Our improved experiment is based upon the topic of YiYe-Wuhan iGEM 2024. The project aims at constructing novel bio-therapeutics through siRNA delivery systems for improving treatments of colorectal cancer (CRC)[1]. The Hippo pathway is a key regulatory pathway in tumorigenesis, it regulates genes that are closely linked to cell proliferation and apoptosis, with TEAD1~4 being a core transcription factor that promotes the growth and spread of CRC cancer cells[2]. Moreover, TEAD4 is upregulated in cancerous tissues compared to paracancerous tissues[3]. Therefore, interfering with the function of TEAD4 is considered an effective strategy to inhibit tumor growth. In our project, we have constructed two shRNA plasmids to inhibit the expression of TEAD4[4]. From our engineering success section, we have concluded that shRNA could indeed decreased the proliferation and migration abilities and increased the ROS level in the CRC cell. For extensions on this project, we propose two other approaches that could possibly have better effects on the same compared categories. The former one being the direct transfection of siRNA into cancer cells. The latter one being the alteration of nuclear translocation of TEAD4, namely NLS (nuclear location sequence) (Figure 1). All experiments are done vitro with the transfection of target gene sequence.

                               
    Figure 1 Schematic diagram of three different methods of improving treatments of colorectal cancer targeting at TEAD4

Design

siRNA wizard software (Invivo gen) (https://www.invivogen.com/sirnawizard/) is used in the design process of siRNA sequence, there are built in algorithms that identify and lowers the off-target possibility of the siRNA. Due to the complex relationship between the pattern of the sequence and the off-target possibility, multiple siRNA sequence is given to us, and we chose two with the least off target possibility. The synthesis of the designed siRNA is done by Tsingke Biotechnology, where we send them the designed sequence and they generate it for us. shRNA follows the same design process but requires a designed hairpin structure that connects the sense and anti-sense strand. Construction of nuclear localization signal (NLS)-deletion TEAD4 （PMMP-TEAD4 △105-109） TEAD4 isoform 1 were cloned by RT-PCR using RNA isolated from cells with primers (GCGGACTCCTTGGAACTGGCTTAG) and (CATCTTGGGTTTATTTG GGGTTGG) of TEAD4, respectively. The RT-PCR products were cloned to pTOPO vector (Invitrogen) and then subjected to DNA sequence analysis. We predicted the potential nuclear localization sequence of TEAD4, LARRK (105-109), using the PSORTⅡ software (https://psort.hgc.jp/).The forward and reverse primers of TEAD4-NLS were CTCCAGCCACATCCAGGTG/GCTCGCGA- GATCCAGGC and GCCTGGATCTCGCGAGC/CACCTGGATGTGGCTGGAG, in which the “ctggctcgtcgcaaa” sequence corresponding to putative nuclear localization signal LARRK (leu-105 to lys-109) was deleted. The first-round PCRs were carried out with TEAD4 cDNA as a template, with primers of EcorRI-TEAD4-F (5’-AACTCGAGTTGGAGGGCACGGCCGGCAC) and TEAD4-NLS-R, TEAD4-NLS-F and BamHI-TEAD4-R (5’-AAGGATCCTCATTCTTTCACCAGCCTG), respectively. The two PCR products were used as template for the second-round PCR with primers EcorRI-TEAD4-F and BamHI-TEAD4-R. The PCR product was sequenced and subcloned to pMMPc vector which number in Addgene is 116920. This generated cDNA sequence was later inserted into CRC cells.

Results

1. Compared three methods on cell proliferation by CCK-8 experiment

Cell Counting Kit-8, is a pragmatic method used to examine the toxicity and proliferation ability of cells. The deeper the color shown on the cell, the faster and more substantial the cell proliferates. To further test the proliferation ability, SW480 cells were transfected with siRNA oligo, sh-TEAD4-1 plasmid and NLS plasmid with different dosage (0 μg, 0.5μg, 1μg, 2μg) (Fig 2). We found that NLS method showed better effect on inhibiting cell proliferation while siRNA displayed little effect on inhibiting cell proliferation.

                         
         Fig.2 the proliferation changes after transfected with three different methods

2.Compared three methods on cell migration by transwell experiment

Transwell experiment is a tool used to measure the migration ability of cells. There are three kinds of plasmids/oligo that we infected into CRC cells, siRNA oligo, sh-TEAD4-1 plasmid and NLS plasmid, respectively. Then we infect 0, 0.5µg, 1µg, 2µg of blank plasmid into the CRC cells. We also found that NLS method showed remarkable effect on inhibiting cell migration while siRNA showed worse function on inhibiting cell migration compared to our sh-TEAD4 method.

                          
          Figure 3 the migration ability detection after transfected with three different methods
                         
            Figure 4 the statistical diagram of migration ability detection 

3.Compared three methods on cell migration of ROS level

The reactive oxygen species, ROS, is a kind of cell’s metabolic product generating by the metabolism of oxygen. One main source of it is the substrate end of the inner mitochondrial membrane. As the metabolic by-product, ROS is considered as the vicious biomacromolecule. The other main source is the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, which is expressed on the plasma membrane. In the normal condition, the amount of ROS stays in a low level. However, when the cell meets stimulus, the ROS level would increase dramatically, exceeding the amount that the cell can process. This would lead to the oxidative stress in the cell, causing the cell’s apoptosis. ROS level is an important marker of cellular oxidative damage caused by normal physiological function and environmental factors. Therefore, it’s necessary to measure the ROS level in our experiment. In our experiment, we transfected the siRNA oligo, sh-TEAD4-1 plasmid and NLS plasmid into the SW480 cancer cell, and we detected the ROS level in these cells. We found that NLS method showed better effect on increasing cell ROS level while siRNA showed worse effect on increasing cell ROS level.

                     
          Figure 5 the ROS level detection after transfected with three different methods
                   
            Figure 6 the statistical diagram of ROS level detection 

Conclusion

From the data of previous results, we can conclude that NLS achieved the greatest outcomes for all of three demonstrations, followed by shRNA, then siRNA (Figure 7). For analysis, siRNA achieved the worst results because that isn't long lasting, its half-life is roughly 48 hours. Normally, RNA will be degraded by really common enzymes, this leads to the loss of effectiveness for siRNA treatments. As an innovative method, NLS achieved even better results, there are multiple approaches that could be thought of and tested because of the complex structures of the hippo pathways. Cancer as a whole is a complex topic, and dealing it requires a better understanding of it. Topics like prohibiting tumor microenvironment (TME) development and metastatic cell regulations can be possible future directions. But more validation is needed for the sake of safety and effectiveness of these types of innovative therapies.

                  
                  
           Figure 7 The summary diagram of the improvement experiment

Reference

[1] Boulikas, Teni. “Putative Nuclear Localization Signals (NLS) in Protein Transcription Factors.” Journal of Cellular Biochemistry, vol. 55, no. 1, May 1994, pp. 32–58. https://doi.org/10.1002/jcb.240550106.

[2] Jung, Hunmin, et al. “The Structure of Importin Α and the Nuclear Localization Peptide of ChREBP, and Small Compound Inhibitors of ChREBP–importin Α Interactions.” Biochemical Journal, vol. 477, no. 17, Sept. 2020, pp. 3253–69. https://doi.org/10.1042/bcj20200520.

[3] Lu, Juane, et al. “Types of Nuclear Localization Signals and Mechanisms of Protein Import Into the Nucleus.” Cell Communication and Signaling, vol. 19, no. 1, May 2021, https://doi.org/10.1186/s12964-021-00741-y.

[4] Tang, Jia-Yin, et al. “TEAD4 Promotes Colorectal Tumorigenesis via Transcriptionally Targeting YAP1.” Cell Cycle, vol. 17, no. 1, Jan. 2018, pp. 102–09. https://doi.org/10.1080/15384101.2017.1403687.

Sequence and Features