Difference between revisions of "Part:BBa K5507009"

 
 
(One intermediate revision by the same user not shown)
Line 17: Line 17:
 
<partinfo>BBa_K5507009 parameters</partinfo>
 
<partinfo>BBa_K5507009 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
'''a. Construction of BBa_K5507009'''
 +
 +
we first constructed an expression cassette containing the Kanamycin resistance gene (kana) flanked by homology arms, each 700-800 bp in length, on either side of the sacB gene. The upstream and downstream homology arms of the sacB gene were amplified by PCR from K. xylinus genomic DNA. The upstream flanking region was amplified using the primers sacB-5-F and sacB-5-R, while the downstream flanking region was amplified using the primers sacB-3-F and sacB-3-R. The Kanamycin resistance gene, used for antibiotic selection, was also amplified by PCR from the pET28a plasmid with the primers Km-F and Km-R. For expression, the tac promoter and rrnB-T terminator fragments were amplified from the expression vector pKK223-3 using the primers Ptac-F, Ptac-R, rrnB-T-F, and rrnB-T-R (figure 1A, 1B).
 +
 +
These five fragments (i.e., the upstream and downstream regions of the sacB gene, tac, rrnB, and kana) were then ligated into the pGEM-T (Easy) vector between the SalI and SacI restriction enzyme sites using T4 DNA ligase, resulting in the BBa_K5507009. The colonies resulting was confirmed by PCR and DNA sequencing of the amplified DNA fragment (figure 1C, 1D).
 +
 +
<html>
 +
<body>
 +
<figure>
 +
<div class = "center">
 +
<center><img src = "https://static.igem.wiki/teams/5507/parts-figures/hw-figure-2.png" style = "width:600px"></center>
 +
</div>
 +
<figcaption><center>Figure 1. Construction of plasmid (pGEM-sacB-5-Ptac-kana-rrnB-T-sacB-3, BBa_K5507009). A. Clone of sacB-5, rrnB-T and sacB-3; B. Clone of kana and Ptac; C. PCR product of kana (primer-F: Atgagccatattcaacgggaaacg；primer-R: ttagaaaaactcatcgagcatc); D. Comparison of sequencing results. </center></figcaption>
 +
</figure>
 +
</body>
 +
</html>
 +
 +
'''b. Construction of K. xylinus-ΔsacB'''
 +
 +
The plasmids pGEM-sacB-5-Ptac-kana-rrnB-T-sacB-3 (BBa_K5507009) was introduced into K. xylinus, located at the sacB gene loci via electroporation. The resulting sacB knockout mutant (ΔsacB) was screened for kanamycin resistance and confirmed by PCR (Figures 2).
 +
 +
<html>
 +
<body>
 +
<figure>
 +
<div class = "center">
 +
<center><img src = "https://static.igem.wiki/teams/5507/parts-figures/hw-figure-4.png" style = "width:600px"></center>
 +
</div>
 +
<figcaption><center>Figure 2. Construction of K. xylinus-ΔsacB. Left: Colonies containing pGEM-sacB-5-Ptac-kana-rrnB-T-sacB-3 (BBa_K5507009), ΔsacB. Right: PCR product of colonies in left. </center></figcaption>
 +
</figure>
 +
</body>
 +
</html>

Latest revision as of 03:01, 30 September 2024


sacB-5-Ptac-kana-rrnB-T-sacB-3

For the subsequent overexpression of the pgi protein in K. xylinus. The Ptac-kana-rrnB-T construct serves as a marker gene in the genome to indicate whether gene recombination has been successful. sacB-5 and sacB-3 are the flanking sequences of the sacB gene.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 785
    Illegal BglII site found at 2203
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 2905
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 1947


a. Construction of BBa_K5507009

we first constructed an expression cassette containing the Kanamycin resistance gene (kana) flanked by homology arms, each 700-800 bp in length, on either side of the sacB gene. The upstream and downstream homology arms of the sacB gene were amplified by PCR from K. xylinus genomic DNA. The upstream flanking region was amplified using the primers sacB-5-F and sacB-5-R, while the downstream flanking region was amplified using the primers sacB-3-F and sacB-3-R. The Kanamycin resistance gene, used for antibiotic selection, was also amplified by PCR from the pET28a plasmid with the primers Km-F and Km-R. For expression, the tac promoter and rrnB-T terminator fragments were amplified from the expression vector pKK223-3 using the primers Ptac-F, Ptac-R, rrnB-T-F, and rrnB-T-R (figure 1A, 1B).

These five fragments (i.e., the upstream and downstream regions of the sacB gene, tac, rrnB, and kana) were then ligated into the pGEM-T (Easy) vector between the SalI and SacI restriction enzyme sites using T4 DNA ligase, resulting in the BBa_K5507009. The colonies resulting was confirmed by PCR and DNA sequencing of the amplified DNA fragment (figure 1C, 1D).

Figure 1. Construction of plasmid (pGEM-sacB-5-Ptac-kana-rrnB-T-sacB-3, BBa_K5507009). A. Clone of sacB-5, rrnB-T and sacB-3; B. Clone of kana and Ptac; C. PCR product of kana (primer-F: Atgagccatattcaacgggaaacg；primer-R: ttagaaaaactcatcgagcatc); D. Comparison of sequencing results.

b. Construction of K. xylinus-ΔsacB

The plasmids pGEM-sacB-5-Ptac-kana-rrnB-T-sacB-3 (BBa_K5507009) was introduced into K. xylinus, located at the sacB gene loci via electroporation. The resulting sacB knockout mutant (ΔsacB) was screened for kanamycin resistance and confirmed by PCR (Figures 2).

Figure 2. Construction of K. xylinus-ΔsacB. Left: Colonies containing pGEM-sacB-5-Ptac-kana-rrnB-T-sacB-3 (BBa_K5507009), ΔsacB. Right: PCR product of colonies in left.