Difference between revisions of "Part:BBa J23150"

Line 33: Line 33:
 
J23114 -> J23151 = 14 % -> 163 % of J23104
 
J23114 -> J23151 = 14 % -> 163 % of J23104
  
https://static.igem.wiki/teams/5102/contribution/promoter-testing.png
+
https://static.igem.wiki/teams/5102/contribution/promoter-testings.png
  
https://static.igem.wiki/teams/5102/contribution/promoter-j23150-j23151-fluorescence.png
+
https://static.igem.wiki/teams/5102/contribution/poromoter-testing.png

Revision as of 14:14, 29 September 2024

1bp mutant from J23107

Group: Munich/Westmeyer lab, 2024 Author: Karl Boegel

Summary: Tongji China team in 2021 demonstrated that J23104 was the most effective in the DHα strain of E. coli. Our experimental approach involved the use of KLD (kinase-ligase-dephosphorylation) technique to ligate PCR products from the pSB1A3_J23106-mTurquoise-B10015 CDSmut plasmid (mTurquoise fluorophore behind J23106 promoter). This involved amplifying the plasmid without the promoter itself, but instead with overhangs that resembled the split promoters J23150 and J23151 each to facilitate overhang ligation.

J23107 -> J23150 150: tttacggctagctcagtcctaggtattatgctagc 107: tttacggctagctcagccctaggtattatgctagc

J23107 -> J23150p J23150p = 352 % % of J23104 The mutation strongly enhances the promoter’s strength above the previously strongest tested promoter of the family.

J23150p -> J23150 J23150 = 219 % of J23104 Still a major optimization in the promoter activity due to reversal of a point mutation causing an Amino acid change in the coding sequence resulting in mTurquoiseL9F, indicating importance of this protein region.

123107 -> J23150p = 50 % -> 352 % of J23104 J2350p -> J23150 = 352 % -> 219 % of J23104


J23114 -> J23151 151: ttgatggctagctcagtcctaggtacaatgctagc 114: ttgacagctagctcagtcctaggtattgtgctagc J2351 = 163 % of J23104 drastic improvement shows that the mutation has a profound effect, bringing a weak promoter above the level of the previously strongest tested promoter.

J23114 -> J23151 = 14 % -> 163 % of J23104

promoter-testings.png

poromoter-testing.png