Difference between revisions of "Part:BBa K5317009"

(→‎Cloning)
(→‎Characterization)
Line 83: Line 83:
  
 
=Characterization=
 
=Characterization=
 +
 +
Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity and specifity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part <span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317012 K5317012]</span>) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.
 +
 +
===Single-transfection experiments===
  
 
<html>
 
<html>
Line 92: Line 96:
  
 
Figure 2: Single-transfected HEK293T cells with the 4xMREa-EGFP-C2 plasmid depicted no EGFP-signal under unstimulated conditions. Scale bar = 20 µm.
 
Figure 2: Single-transfected HEK293T cells with the 4xMREa-EGFP-C2 plasmid depicted no EGFP-signal under unstimulated conditions. Scale bar = 20 µm.
 +
 +
The single transfection with the 4xMREa-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about sensitivity and specificity of the promoter under homeostatic conditions. Therefore, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditons.
  
 
=Reference=
 
=Reference=
  
 
Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985
 
Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985

Revision as of 14:12, 28 September 2024


4xMREa-EGFP

Usage and Biology

The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.

In an effort to increase the efficiency of the activated MTF-1-responsive promoter, we constructed a synthetic promoter with multiple MREa sites. Searle and colleagues described 1985 that at least two MREa sites are necessary for the zinc-induced expression of the downstream gene, here herpes simplex virus thymidine kinase. They also showed that the positioning of the MREs in the promoter sequence had little effect on the promoter efficiency but was increased with more MREa sites inserted. Therefore, we put a promoter together with four MREa sites positioned at the sites of the MREwt promoter (K5317003).

Cloning

Theoretical Part Design

Placing the 4xMREa-containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Cloning

The promoter was synthesized and inserted by NEB HiFi Assembly into the pEGFP-C2 backbone plasmid (K3338020) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette. The assembled plasmid is shown in figure 1.

HTML Table Caption Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone

Primer name Sequence
4xMREa_fw CCGCCATGCATTAGTTATGCACACTGGCGCT
4xMREa_rev TGGCGACCGGTAGCGGACGCTTAGAGGACAGC

Figure 1: Assembled vector map with 4xMREa-EGFP integrated into the pEGFP-C2 backbone.

Characterization

Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity and specifity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF-1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.

Single-transfection experiments

Figure 2: Single-transfected HEK293T cells with the 4xMREa-EGFP-C2 plasmid depicted no EGFP-signal under unstimulated conditions. Scale bar = 20 µm.

The single transfection with the 4xMREa-EGFP-C2 plasmid in HEK293T cells showed no base signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about sensitivity and specificity of the promoter under homeostatic conditions. Therefore, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditons.

Reference

Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985