Difference between revisions of "Part:BBa K5267043"

 
Line 3: Line 3:
 
<partinfo>BBa_K5267043 short</partinfo>
 
<partinfo>BBa_K5267043 short</partinfo>
  
−
The transformation of calcium ion concentration is reported by fluorescence
+
Transpose and respond to calcium ion signals
−
 
+
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===
Line 17: Line 16:
 
<partinfo>BBa_K5267043 parameters</partinfo>
 
<partinfo>BBa_K5267043 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===Profile===
 +
Name: P_1*NFAT->IgK->Nluc->bGH_polyA
 +
<br>Base Pairs: 1067bp
 +
<br>Origin: Homo sapiens
 +
<br>Properties: The transformation of calcium ion concentration is reported by fluorescence
 +
 +
 +
===Usage and Biology===
 +
At present, some people have successfully designed a series of repetitive pseudo-palindromic NFAT reaction element guided by nano-luciferase reporter gene system[1].
 +
<br>We developed a series of Ca2-induced NanoLuc reporting systems based on Ca2+ dependent activation of dimer NFAT to monitor the effects of increased Ca2+ concentration in downstream pathways following melatonin receptor response on cells. (figure. 1)
 +
<br>The system is divided into two parts: the signal response element (encoded by [[Part: BBa_ K5267007]]) and the detection report element (encoded by [[Part: BBa_ K2728003]]).
 +
<br>HEK293 cells were co-transfected with a newly designed NanoLuc reporter expression plasmid to construct a NFAT response element (RE) -directed Nanoluc reporting system. With the NanoLuc reporter gene, we can detect the activation of the NFAT signaling pathway.
 +
<html>
 +
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/8.jpg" class="figure-img img-fluid rounded"  height="100px">
 +
 +
</figure>
 +
 +
</html>
 +
<br>'''Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed Nanoluc reporter system.'''
 +
 +
 +
===Special design===
 +
In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1[2].
 +
<br>These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. '''(Figure 1)'''
 +
<br>To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]
 +
<html>
 +
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/8.jpg" class="figure-img img-fluid rounded"  height="200px">
 +
 +
</figure>
 +
 +
</html>
 +
<br>Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.
 +
 +
===Function test===
 +
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. '''(Figure 2)'''
 +
In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
 +
<html>
 +
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/3.jpg" class="figure-img img-fluid rounded"  height="400px">
 +
 +
</figure>
 +
 +
</html>
 +
<br>In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
 +
 +
 +
===Sequence===
 +
Top:
 +
<br>ggagtacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttt
 +
<br>atacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttagaccctagag
 +
<br>ggtatataatggaagctcgacttccagtact
 +
 +
===Reference===
 +
[1] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
 +
<br>[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.

Revision as of 09:40, 28 September 2024


P_1xNFAT->IgK->Nluc->bGH_polyA

Transpose and respond to calcium ion signals Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 190
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: P_1*NFAT->IgK->Nluc->bGH_polyA
Base Pairs: 1067bp
Origin: Homo sapiens
Properties: The transformation of calcium ion concentration is reported by fluorescence


Usage and Biology

At present, some people have successfully designed a series of repetitive pseudo-palindromic NFAT reaction element guided by nano-luciferase reporter gene system[1].
We developed a series of Ca2-induced NanoLuc reporting systems based on Ca2+ dependent activation of dimer NFAT to monitor the effects of increased Ca2+ concentration in downstream pathways following melatonin receptor response on cells. (figure. 1)
The system is divided into two parts: the signal response element (encoded by Part: BBa_ K5267007) and the detection report element (encoded by Part: BBa_ K2728003).
HEK293 cells were co-transfected with a newly designed NanoLuc reporter expression plasmid to construct a NFAT response element (RE) -directed Nanoluc reporting system. With the NanoLuc reporter gene, we can detect the activation of the NFAT signaling pathway.


Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed Nanoluc reporter system.


Special design

In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1[2].
These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. (Figure 1)
To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]


Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.

Function test

In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. (Figure 2) In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.


In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.


Sequence

Top:
ggagtacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttt
atacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttagaccctagag
ggtatataatggaagctcgacttccagtact

Reference

[1] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.