Difference between revisions of "Part:BBa K5317019"

(→‎Usage and Biology)
Line 8: Line 8:
  
 
===Theoretical Part Design===
 
===Theoretical Part Design===
−
Placing the ccpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K3338014]</span>)upstream of the reporter gene mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>) allows for visualisation of location of ccpA. This composite part was cloned by using the primers in table 1.
+
Placing the ccpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K3338014]</span>)upstream of the reporter gene mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>) allows for visualisation of location of ccpA.  
 +
<!-- -->
 +
<span class='h3bb'>
 +
 
 +
===Sequence and Features===
 +
</span>
 +
<partinfo>BBa_K5317019 SequenceAndFeatures</partinfo>
 +
 
 +
===Cloning===
 +
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI and inserted the both genes ccpA(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K33380014]</span>) and mRuby2(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>), which were fused bevorhand together with matching overhangs. The ccpA gene was acquired from ''S. aureus''. Following the NEBBuilder® user protocol this vector was cloned via HIFI assembly method.his composite part was cloned by using the primers in table 1.
  
 
<html>  
 
<html>  
Line 76: Line 85:
  
 
</html>
 
</html>
−
<!-- -->
 
−
<span class='h3bb'>
 
  
−
===Sequence and Features===
+
<html>
−
</span>
+
<center>
−
<partinfo>BBa_K5317019 SequenceAndFeatures</partinfo>
+
<img src="https://static.igem.wiki/teams/5317/ccpa-mruby2.png" style="width: 50%; height: 50%">
−
 
+
</p>
−
===Cloning===
+
</center>
−
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI and inserted the both genes ccpA(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K33380014]</span>) and mRuby2(<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338001 K3338001]</span>), which were fused bevorhand together with matching overhangs. The ccpA gene was acquired from ''S. aureus''. Following the NEBBuilder® user protocol this vector was cloned via HIFI assembly method.
+
</html>
  
 
=Characterisation=  
 
=Characterisation=  
  
−
===References===
+
=References=
  
 
Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. ''Journal of Bacteriology'', 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21
 
Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. ''Journal of Bacteriology'', 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21
  
 
Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. ''Journal of Biological Chemistry'', 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587
 
Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. ''Journal of Biological Chemistry'', 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587

Revision as of 18:11, 27 September 2024

CMV-CcpA-mRuby2


Usage and Biology

The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to a specifically engineered promoter. We therefore used an mRuby2 (K3338001)marker gene to detect localisation of ccpA protein in HEK292T cells.

Theoretical Part Design

Placing the ccpA (K3338014)upstream of the reporter gene mRuby2 (K3338001) allows for visualisation of location of ccpA.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 1669

Cloning

We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI and inserted the both genes ccpA(K33380014) and mRuby2(K3338001), which were fused bevorhand together with matching overhangs. The ccpA gene was acquired from S. aureus. Following the NEBBuilder® user protocol this vector was cloned via HIFI assembly method.his composite part was cloned by using the primers in table 1.

HTML Table Caption Table1: Primers used to extract and clone the ccpA gene sequence.

Primer name Sequence
ccpA_fw_1 tggatccccttttgtagttcctcggtattcaattctgtgag
ccpA_rv_2 TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc
ccpA_fw_3 actacaaaaggggatccaccggtcg
ccpA_rv_4 TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc

Characterisation

References

Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. Journal of Bacteriology, 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21

Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. Journal of Biological Chemistry, 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587