Difference between revisions of "Part:BBa K5317015"
(→‎Theoretical Part Design)
Line 12: Line 12:
  
 
===Theoretical Part Design===
 
===Theoretical Part Design===
−
We placed the mRuby2 fluorescent marker (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) downstream behind graR. This gene was codon optimised for human cell lines.
+
We placed the mRuby2 fluorescent marker (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) downstream behind graR. This gene was codon optimised for human cell lines. This part was amplified by using the primers in table 1.
  
 
<html>  
 
<html>  

Revision as of 16:04, 26 September 2024


GraR

Usage and Biology

GraR is known for its role in β-lactam resistance by upregulating cell wall biosynthesis genes, altering cell wall composition, and increasing expression of ABC-transporters (El-Halfawy et al., 2020; Yang et al., 2012; Meehl et al., 2007). The GraSR system is a two-component regulatory system that controls the expression of many genes involved in stress response, cell wall metabolism and virulence pathways in Staphylococcus aureus (Falord et al., 2011).

Accordingly, GraR functions as a transcription factor and our cell-based antiobiotics sensor utilises it as such by aiming for its PknB-dependent phyosphorylation (K5317013).

Cloning

Theoretical Part Design

We placed the mRuby2 fluorescent marker (K5317001) downstream behind graR. This gene was codon optimised for human cell lines. This part was amplified by using the primers in table 1.

HTML Table Caption Table1: Primers used to extract the graR gene sequence.

Primer name Sequence
graR_fw_1 TGAACCGTCAGATCCGatgcaaatactactagtagaagatgacaatactttgt
graR_rv_1 tggatccccttcatgagccatatatccttttcctacttttgt

Sequence and Features

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 235
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 235
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 235
  • 1000
    COMPATIBLE WITH RFC[1000]

References

El-Halfawy, O. M., Czarny, T. L., Flannagan, R. S., Day, J., Bozelli, J. C., Kuiack, R. C., Salim, A., Eckert, P., Epand, R. M., McGavin, M. J., Organ, M. G., Heinrichs, D. E., & Brown, E. D. (2020). Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. Nature Chemical Biology, 16(2), 143–149. https://doi.org/10.1038/s41589-019-0401-8

Falord, M., Mäder, U., Hiron, A., Débarbouillé, M., & Msadek, T. (2011). Investigation of the Staphylococcus aureus GraSR Regulon Reveals Novel Links to Virulence, Stress Response and Cell Wall Signal Transduction Pathways. PLoS ONE, 6(7), e21323. https://doi.org/10.1371/journal.pone.0021323

Meehl, M., Herbert, S., Götz, F., & Cheung, A. (2007). Interaction of the GraRS Two-Component System with the VraFG ABC Transporter To Support Vancomycin-Intermediate Resistance in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy , 51(8), 2679–2689. https://doi.org/10.1128/AAC.00209-07

Yang, S.-J., Bayer, A. S., Mishra, N. N., Meehl, M., Ledala, N., Yeaman, M. R., Xiong, Y. Q., & Cheung, A. L. (2012). The Staphylococcus aureus Two-Component Regulatory System, GraRS, Senses and Confers Resistance to Selected Cationic Antimicrobial Peptides. Infection and Immunity, 80(1), 74–81. https://doi.org/10.1128/IAI.05669-11