Difference between revisions of "Part:BBa K5267010"
Line 9: Line 9:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
−
<partinfo>BBa_K5267010 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K5267008 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
−
<partinfo>BBa_K5267010 parameters</partinfo>
+
<partinfo>BBa_K5267008 parameters</partinfo>
 
<!-- -->
 
<!-- -->
  
 
===Profile===
 
===Profile===
−
Name: P_min5*NFAT_IL4
+
Name: Pmin_7*NFAT promoter
 
<br>Base Pairs: 191bp
 
<br>Base Pairs: 191bp
 
<br>Origin: Homo sapiens  
 
<br>Origin: Homo sapiens  
Line 25: Line 25:
  
 
===Usage and Biology===
 
===Usage and Biology===
−
P_min is short for minimal promoter, which is the minimal version of the promoter sequence that contains elements necessary for transcription factor binding, but usually does not contain enhancers or other regulatory elements<sup>[1]</sup>.
+
Nuclear factor of activated T cells (NFAT) was first identified more than two
−
<br>NFAT_IL4 is a component of interleukin-4 (IL-4) transcription promoter which is responsive to nuclear factor of activated T cells (NFAT). And NFAT can response to calcium ions. In our project, we choose calcium pathway as one of the downstream pathways of melatonin receptor MT1. So NFAT_IL4 can characterize the binding of melatonin and MT1.
+
decades ago as a major stimulation-responsive DNA-binding factor and transcriptional
 +
regulator in T cells. NFAT is a family of transcription factors. It was originally discovered in activated T cells as a transcription factor capable of binding to the promoter of human interleukin-2 (IL2) to rapidly induce its expression. Widely expressed in a variety of animal tissues and cells, NFAT is a key regulatory point of multiple intracellular signal transduction pathways, and also plays an important role in immune system, nervous system development, axon growth, and nervous system diseases，in this project it used to indirectly monitor effects of increases in the intracellular Ca2+ concentrations.[1]
  
  
 
===Special design===
 
===Special design===
−
5*NFAT_IL4 is the 5-fold version of NFAT_IL4. Considering that the expression effect of a single responder is weak, we insert multiple tandem repeats of the same responder element to the upstream of P_min to enhance the activation of the signaling pathway. This part is the combination of NFAT_IL4 clone four times and P_min.
+
In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1A[2].
 +
<br>These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-GGAATTTCC-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. '''(Figure 1)'''
 +
<br>To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]
 +
<html>
 +
 
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/7.jpg" class="figure-img img-fluid rounded"  height="200px">
 +
 
 +
</figure>
 +
 
 +
</html>
 +
<br>Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.
  
  
 
===Function test===
 
===Function test===
−
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. '''(Figure 1)'''
+
In order to test the function of calcium ion response element, Pmin_7*NFAT promoter is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and Pmin_7*NFAT promoter. '''(Figure 2)'''
−
In Figure 1, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
+
In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with Pmin_7*NFAT promoter is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
 
<html>
 
<html>
  
Line 41: Line 54:
 
<div style="width=100%;height=auto;align-items:center">
 
<div style="width=100%;height=auto;align-items:center">
 
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/3.jpg" class="figure-img img-fluid rounded"  height="400px">
 
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/3.jpg" class="figure-img img-fluid rounded"  height="400px">
 +
 +
</figure>
  
 
</html>
 
</html>
 +
<br>In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with Pmin_7*NFAT promoter is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
  
  
 
===Sequence===
 
===Sequence===
 
Top:  
 
Top:  
−
<br>GGAGTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTA
+
<br>ggagtacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttt
−
<br>GCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTAGACTCTAGAGGGTATATAATGGAAGCTCGACTTC
+
<br>atacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttagaccctagag
−
<br>CAGTACT
+
<br>ggtatataatggaagctcgacttccagtact
−
 
+
  
 
===Reference===
 
===Reference===
−
[1] Hawley DK, McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25.
+
[1] M. R. Müller and A. Rao, “NFAT, immunity and cancer: a transcription factor comes of age,” Nat. Rev. Immunol., vol. 10, no. 9, pp. 645–656, Sep. 2010, doi: 10.1038/nri2818.
−
<br>[2] Rao, A., Luo, C., & Hogan, P.G. (1997). Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 1997.
+
<br>[2] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
−
<br>[3] Rooney JW, Hodge MR, McCaffrey PG, Rao A, Glimcher LH. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 1994 Feb 1.
+
<br>[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.

Revision as of 19:14, 24 September 2024


Pmin_7*NFAT promoter

Transpose and respond to calcium ion signals Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: Pmin_7*NFAT promoter
Base Pairs: 191bp
Origin: Homo sapiens
Properties: Transpose and respond to calcium ion signals


Usage and Biology

Nuclear factor of activated T cells (NFAT) was first identified more than two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFAT is a family of transcription factors. It was originally discovered in activated T cells as a transcription factor capable of binding to the promoter of human interleukin-2 (IL2) to rapidly induce its expression. Widely expressed in a variety of animal tissues and cells, NFAT is a key regulatory point of multiple intracellular signal transduction pathways, and also plays an important role in immune system, nervous system development, axon growth, and nervous system diseases，in this project it used to indirectly monitor effects of increases in the intracellular Ca2+ concentrations.[1]


Special design

In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1A[2].
These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-GGAATTTCC-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. (Figure 1)
To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]


Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.


Function test

In order to test the function of calcium ion response element, Pmin_7*NFAT promoter is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and Pmin_7*NFAT promoter. (Figure 2) In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with Pmin_7*NFAT promoter is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.


In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with Pmin_7*NFAT promoter is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.


Sequence

Top:
ggagtacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttt
atacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttagaccctagag
ggtatataatggaagctcgacttccagtact

Reference

[1] M. R. Müller and A. Rao, “NFAT, immunity and cancer: a transcription factor comes of age,” Nat. Rev. Immunol., vol. 10, no. 9, pp. 645–656, Sep. 2010, doi: 10.1038/nri2818.
[2] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.