Difference between revisions of "Part:BBa K5267002"
Line 1: Line 1:
 +
__NOTOC__
 +
<partinfo>BBa_K5267002 short</partinfo>
 +
 +
GPCRs
 +
 +
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===
−
MT2(melatonin receptor type 2) is an integral membrane protein that is a G protein coupled receptor (GPCR), 7-transmembrane receptor. It is found primarily in the retina and brain. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin.[1]  
+
 
 +
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K5267002 SequenceAndFeatures</partinfo>
 +
 
 +
 
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K5267002 parameters</partinfo>
 +
<!-- -->
 +
 
 +
===Profile===
 +
Name: MTNR1B
 +
<br>Pairs: 1089bp
 +
<br>Origin: Homo sapiens
 +
<br>Properties: GPCRs
 +
 
 +
 
 +
===Usage and Biology===
 +
MT2(melatonin receptor type 2) is an integral membrane protein that is a G protein coupled receptor (GPCR), 7-transmembrane receptor. It is found primarily in the retina and brain. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin.<sup>[1]</sup>
 
MT2 has been reported to modulate many physiological processes, especially those related to sleep and circadian rhythm regulation, but also in retina physiology, pain and neuronal and immune functions.
 
MT2 has been reported to modulate many physiological processes, especially those related to sleep and circadian rhythm regulation, but also in retina physiology, pain and neuronal and immune functions.
−
Figure: Overall structures of MT2 (F: inactive state [PDB ID: 6ME6], J: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (G) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (K) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. [3]
+
<html>
 +
 
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/4.jpg" class="figure-img img-fluid rounded"  height="400px">
 +
 
 +
</html>
 +
 
 +
<br>Figure: Overall structures of MT2 (F: inactive state [PDB ID: 6ME6], J: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (G) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (K) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. <sup>[3]</sup>
 +
 
  
 
===Signal transduction features===
 
===Signal transduction features===
 
As a class of GPCR, MT2 mainly transmits signals through G protein coupling. MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein by activating Gαi/oA, inhibiting the intracellular AC activity and reducing the intracellular cAMP concentration. MT2 also inhibits the activity of guanylyl cyclase (GC) and reducing the intracellular cGMP concentration, to regulate cGMP-dependent signaling pathways. MT2 can also regulate gene expression by coupling with Gαq/11 protein to activate PLC, increase intracellular Ca2+ level, and activate PKC pathway to promote downstream signal transduction. [2]
 
As a class of GPCR, MT2 mainly transmits signals through G protein coupling. MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein by activating Gαi/oA, inhibiting the intracellular AC activity and reducing the intracellular cAMP concentration. MT2 also inhibits the activity of guanylyl cyclase (GC) and reducing the intracellular cGMP concentration, to regulate cGMP-dependent signaling pathways. MT2 can also regulate gene expression by coupling with Gαq/11 protein to activate PLC, increase intracellular Ca2+ level, and activate PKC pathway to promote downstream signal transduction. [2]
−
In terms of transcriptional regulation, melatonin signaling typically inhibits cAMP-responsive element binding (CREB), which activates gene transcription though the ERK pathway. [3]
+
<br>In terms of transcriptional regulation, melatonin signaling typically inhibits cAMP-responsive element binding (CREB), which activates gene transcription though the ERK pathway. [3]
−
The figure from Okamoto, H. H., Cecon, E., Nureki, O., Rivara, S., & Jockers, R. (2024) shows melatonin receptor-mediated signal transduction. (Fig.1)  
+
<br>The figure from Okamoto, H. H., Cecon, E., Nureki, O., Rivara, S., & Jockers, R. (2024) shows melatonin receptor-mediated signal transduction. (Fig.1)  
−
Figure 1. Melatonin receptor signaling pathways. [3]  
+
 
−
===References===
+
<html>
−
[1] R. Jockers et al., “Update on melatonin receptors: IUPHAR Review 20,” Br. J. Pharmacol., vol. 173, no. 18, pp. 2702–2725, Sep. 2016, doi: 10.1111/bph.13536.
+
 
 +
<figure class="figure">
 +
<div style="width=100%;height=auto">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/5.png" class="figure-img img-fluid rounded"  height="400px">
 +
 
 +
</html>
 +
<br>Figure 1. Melatonin receptor signaling pathways. [3]  
 +
===Function test===
 +
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. '''(Figure 1)'''
 +
In Figure 1, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
 +
 
 +
 
 +
===Sequence===
 +
Top:  
 +
<br>GGAGTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTA
 +
<br>GCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTAGACTCTAGAGGGTATATAATGGAAGCTCGACTTC
 +
<br>CAGTACT
  
−
[2] “Melatonin receptor structure and signaling,” J. Pineal Res., vol. 76, no. 3, p. e12952, Apr. 2024, doi: 10.1111/jpi.12952.
 
  
−
[3] Y. Gao, S. Zhao, Y. Zhang, and Q. Zhang, “Melatonin Receptors: A Key Mediator in Animal Reproduction,” Vet. Sci., vol. 9, no. 7, p. 309, Jun. 2022, doi: 10.3390/vetsci9070309.
+
===Reference===
 +
[1] Hawley DK, McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25.
 +
<br>[2] Rao, A., Luo, C., & Hogan, P.G. (1997). Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 1997.
 +
<br>[3] Rooney JW, Hodge MR, McCaffrey PG, Rao A, Glimcher LH. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 1994 Feb 1.

Revision as of 17:22, 23 September 2024

Mammalian MT2 melatonin receptor

GPCRs

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: MTNR1B
Pairs: 1089bp
Origin: Homo sapiens
Properties: GPCRs


Usage and Biology

MT2(melatonin receptor type 2) is an integral membrane protein that is a G protein coupled receptor (GPCR), 7-transmembrane receptor. It is found primarily in the retina and brain. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin.[1] MT2 has been reported to modulate many physiological processes, especially those related to sleep and circadian rhythm regulation, but also in retina physiology, pain and neuronal and immune functions.


Figure: Overall structures of MT2 (F: inactive state [PDB ID: 6ME6], J: active state [PDB ID: 7VH0]). Overall TM6 movement during receptor activation of MT 2(inactive state: [PDB ID: 6ME9] and active state: [PDB ID: 7VH0]). (G) Ligand binding site of crystal structures of MT 2 (left: [PDB ID: 6ME6], right: [PDB ID: 6ME9]). (K) Ligand binding site of cryo‐EM structure of MT2 [PDB ID: 7VH0]. [3]


Signal transduction features

As a class of GPCR, MT2 mainly transmits signals through G protein coupling. MT2 regulates the activities of protein kinase A (PKA) and cAMP response element-binding protein by activating Gαi/oA, inhibiting the intracellular AC activity and reducing the intracellular cAMP concentration. MT2 also inhibits the activity of guanylyl cyclase (GC) and reducing the intracellular cGMP concentration, to regulate cGMP-dependent signaling pathways. MT2 can also regulate gene expression by coupling with Gαq/11 protein to activate PLC, increase intracellular Ca2+ level, and activate PKC pathway to promote downstream signal transduction. [2]
In terms of transcriptional regulation, melatonin signaling typically inhibits cAMP-responsive element binding (CREB), which activates gene transcription though the ERK pathway. [3]
The figure from Okamoto, H. H., Cecon, E., Nureki, O., Rivara, S., & Jockers, R. (2024) shows melatonin receptor-mediated signal transduction. (Fig.1)


Figure 1. Melatonin receptor signaling pathways. [3]

Function test

In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. (Figure 1) In Figure 1, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.


Sequence

Top:
GGAGTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTA
GCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTAGACTCTAGAGGGTATATAATGGAAGCTCGACTTC
CAGTACT


Reference

[1] Hawley DK, McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25.
[2] Rao, A., Luo, C., & Hogan, P.G. (1997). Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 1997.
[3] Rooney JW, Hodge MR, McCaffrey PG, Rao A, Glimcher LH. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 1994 Feb 1.