Difference between revisions of "Part:BBa K5267011"

Revision as of 09:58, 22 September 2024

mPGK Promoter

Sequence and Features

Profile

Name: mPGK promoter
Base Pairs: 516bp
Origin: Mouse
Properties: promoter that responsible for transcription of MTNR1a

Usage and Biology

MPGK promoter(mpPGK) is the promoter of Pgk1 in mouse cell. Pgk-1 is the murine gene encoding phosphoglycerate kinase (PGK), a key enzyme in glycolysis. This enzyme must be present in all cells, so the Pgk-1 promoter is expected to be a ubiquitously active one^[1]. The cloned mpPGK is very active in driving transcription of reporter genes following transfection into mammalian cells^[2]. The promoter is particularly active in pluripotent embryonal carcinoma and embryonic stem cells.
An initial studie on the Pgk-1 promoter indicated that its activity was contained within a region from −425 bp to +80 bp relative to the first transcription start site[2]. This promoter is GC rich and contains no TATA box^[3]. The data from John P. Thomson et al. indicate that a primary function of non-methylated CGIs is to genetically influence the local chromatin modification state to initiate transcriptionby interaction with Cfp1 and perhaps other CpG-binding proteins^[4]. The core promoter from −121 bp to +80 bp contains a number of putative Spl binding sites and had modest promoter activity. The 304 bp upstream of the core promoter had enhancer-like activity such that this region increased expression from the core promoter in an orientation- and position-independent fashion.

Figure

Regulated expression from the Pgk-1 promoter carrying the UAS. The Pgk-1 promoter comprising the region spanning −425 to +80 bp (black bars) and −121 to +80 bp were used to drive the lacZ reporter gene. (A) These constructs were cotransfected into P19 cells along with an RSV-driven CAT construct and harvested 48 h later. The P19 cells were treated with retinoic acid (RA) for the number of days shown before cells were harvested for measurement of β-galactosidase and CAT activities. (B) The two test constructs were cotransfected along with a selectible gene, Pgk-puro, and stably transformed cells were selected in puromycin. Colonies of transformed cells were pooled and treated with RA for the number of days shown before being harvested for β-galactosidase and CAT activities. The activity shown is that of β-galactosidase normalized to the CAT control.[1]

Sequence

Top:
GGAGCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGC
CTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTA
GTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCAGTAGTCTCGTGCAGATGGACAG
CACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGG
GTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAG
CGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTCCAGCCCTACT

Reference

[1] SUTHERLAND L C, ST-ARNAUD R, MCBURNEY M W. An upstream activator sequence regulates the murine Pgk-1 promoter and binds multiple nuclear proteins [J]. Gene expression, 1995, 4(4-5): 265-79.
[2] MCBURNEY M W, SUTHERLAND L C, ADRA C N, et al. The mouse Pgk-1 gene promoter contains an upstream activator sequence [J]. Nucleic acids research, 1991, 19(20): 5755-61.
[3] ADRA C N, BOER P H, MCBURNEY M W. Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter [J]. Gene, 1987, 60(1): 65-74.
[4] THOMSON J P, SKENE P J, SELFRIDGE J, et al. CpG islands influence chromatin structure via the CpG-binding protein Cfp1 [J]. Nature, 2010, 464(7291): 1082-U162.