Difference between revisions of "Part:BBa K5143025"
| Line 7: | Line 7: | ||
<h1>Description</h1> | <h1>Description</h1> | ||
<p> | <p> | ||
| − | This part was designed to be used in <i> Saccharomyces cerevisiae <i>. Its main components are fwYellow (<a href="https://parts.igem.org/Part:BBa_K5143023">BBa_K5143023</a>) and Cp19k-MaSp1 | + | This part was designed to be used in <i> Saccharomyces cerevisiae </i>. Its main components are <i> fwYellow </i> (<a href="https://parts.igem.org/Part:BBa_K5143023">BBa_K5143023</a>) and <i> Cp19k-MaSp1 </i> |
(<a href="https://parts.igem.org/Part:BBa_K5143022">BBa_K5143022</a>) fused together (<a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a>). | (<a href="https://parts.igem.org/Part:BBa_K5143022">BBa_K5143022</a>) fused together (<a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a>). | ||
| − | By digesting this part with XhoI restriction enzyme, the linearized fragment could be transformed into the yeast in order to recombinate with the Ura locus in <i> S. cerevisiae <i> BY4741 strain. Then, the yeast will express the alphafactor-fwYellow-CBD-P2A-alphafactor-MaSp1-CBD gene. | + | By digesting this part with XhoI restriction enzyme, the linearized fragment could be transformed into the yeast in order to recombinate with the Ura locus in <i> S. cerevisiae </i> BY4741 strain. Then, the yeast will express the alphafactor-fwYellow-CBD-P2A-alphafactor-MaSp1-CBD gene. |
In our project, these two proteins will be secreted by the yeast and will bind to the cellulose (thanks to the fused CBD) in order to functionalize the cellulose. | In our project, these two proteins will be secreted by the yeast and will bind to the cellulose (thanks to the fused CBD) in order to functionalize the cellulose. | ||
</p> | </p> | ||
Revision as of 15:06, 21 September 2024
Plasmid D
Description
This part was designed to be used in Saccharomyces cerevisiae . Its main components are fwYellow (BBa_K5143023) and Cp19k-MaSp1 (BBa_K5143022) fused together (BBa_K5143024). By digesting this part with XhoI restriction enzyme, the linearized fragment could be transformed into the yeast in order to recombinate with the Ura locus in S. cerevisiae BY4741 strain. Then, the yeast will express the alphafactor-fwYellow-CBD-P2A-alphafactor-MaSp1-CBD gene. In our project, these two proteins will be secreted by the yeast and will bind to the cellulose (thanks to the fused CBD) in order to functionalize the cellulose.
Construction
The codons were optimised for synthesis and expression in Saccharomyces cerevisiae .
MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT
This composite part is part of the following larger composite part: BBa_K5143024
It was synthesized in its entirety and then cloned via PCR into the following plasmid: BBa_K5143005
References
Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922.