Difference between revisions of "Part:BBa K5143003"
| Line 1: | Line 1: | ||
| − | Description | + | <html lang="en"> |
| − | Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of | + | <head> |
| − | + | <meta charset="UTF-8"> | |
| − | + | <meta name="viewport" content="width=device-width, initial-scale=1.0"> | |
| − | Construction | + | <title>Protein Description</title> |
| − | The codons were optimised for synthesis and expression in Saccharomyces cerevisiae. | + | </head> |
| − | MaSp1 and Cp19k are fused with the GS linker : GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT | + | <body> |
| − | This composite part is part of the following larger composite part: put name composite part | + | <h1>Description</h1> |
| − | It was synthesized in its entirety and then cloned via PCR into the following plasmid: | + | <p> |
| − | + | Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of Cp19k-MaSp1 was higher than that of individual proteins. Adhesion strength: 39.9.7 mJ/m² | |
| − | + | </p> | |
| − | References | + | <img src="https://static.igem.wiki/teams/5143/cp19k-masp1-bba-k5143003.png" width="400" alt="Cp19k-MaSp1"> |
| − | Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922. | + | <h1>Construction</h1> |
| + | <p> | ||
| + | The codons were optimised for synthesis and expression in Saccharomyces cerevisiae. <br> | ||
| + | MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT <br> | ||
| + | This composite part is part of the following larger composite part: put name composite part <br> | ||
| + | It was synthesized in its entirety and then cloned via PCR into the following plasmid: <a href="https://parts.igem.org/Part:BBa_K5143005" target="_blank">BBa_K5143005</a> | ||
| + | </p> | ||
| + | <h1>References</h1> | ||
| + | <p> | ||
| + | Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: <a href="https://doi.org/10.1016/j.ijbiomac.2023.127125" target="_blank">10.1016/j.ijbiomac.2023.127125</a>. Epub 2023 Sep 28. PMID: 37776922. | ||
| + | </p> | ||
| + | </body> | ||
| + | </html> | ||
Revision as of 16:39, 29 July 2024
Description
Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of Cp19k-MaSp1 was higher than that of individual proteins. Adhesion strength: 39.9.7 mJ/m²
Construction
The codons were optimised for synthesis and expression in Saccharomyces cerevisiae.
MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT
This composite part is part of the following larger composite part: put name composite part
It was synthesized in its entirety and then cloned via PCR into the following plasmid: BBa_K5143005
References
Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922.