Difference between revisions of "Part:BBa K5133005"

Revision as of 08:51, 27 July 2024

Microcin H47

Group: GEC-China (iGEM 2024, team number: #5133)

Brief introduction

This basic part is derived from plasmid pFB399^[1], including a DNA sequence for coding Microcin H47, an antimicrobial peptide produced by probiotic E. coli Nissle 1917. By assembling with T7 promoter (BBa_K5133000), RBS (BBa_K5133001), and T7 terminator (BBa_K5133003) derived from plasmid pJL1^[2], this part is used for the construction of composite part BBa_K5133006 to demonstrate the in vitro production of antimicrobial peptides by CFPS.

Design and characterization

The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. To validate the correctness of DNA sequence, result of Sanger sequencing for BBa_K5133006 show the successful assembly among T7 promoter (BBa_K5133000), RBS (BBa_K5133001), Microcin H47 (this part), and T7 terminator (BBa_K5133003) in Figure 2.

Usages

This part is used for the construction of composite part BBa_K5133006 (Microcin H47 generator) to demonstrate the feasibility of in vitro antimicrobial peptide production by CFPS.

DNA sequence (from 5' to 3')

atgcgagaaataacagaatcacagttaagatatatttccggggcgggaggtgcgccagcgacttcagctaatgctgcaggtgctgcagctattgttggagctctcgccggaatacctggtggtccacttggggttgta gttggagccgtatctgccggtttgacaacagcaattggctcgaccgtgggaagtggtagtgccagttcttctgctggtggcggtagccatcatcatcatcatcactaa

Red font: 6×His-Tag, for detecting the in vitro production of Microcin H47 by Western-Blot analysis

References

[1] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327

[2] https://www.addgene.org/69496/

Sequence and Features