Difference between revisions of "Part:BBa K5133005"

 
Line 3: Line 3:
 
<partinfo>BBa_K5133005 short</partinfo>
 
<partinfo>BBa_K5133005 short</partinfo>
  
−
TBD
+
Group: <b>GEC-China (iGEM 2024, team number: #5133)</b>
 +
 
 +
 
 +
==<b>Brief introduction</b>==
 +
 
 +
This basic part is derived from plasmid pFB399<sup>[1]</sup>, including an DNA sequence for coding Microcin H47, an antimicrobial peptide produced by probiotic <i>E. coli</i> Nissle 1917. By assembling this part with T7 promoter (<bbpart>BBa_K5133000</bbpart>), RBS (<bbpart>BBa_K5133001</bbpart>), and T7 terminator (<bbpart>BBa_K5133003</bbpart>) with iGEM standard backbone <bbpart>pSB1C3</bbpart>,  this part is used for the construction of composite part <bbpart>BBa_K5133006</bbpart> to demonstrate the <i>in vitro</i> production of antimicrobial peptides by CFPS.
 +
 
 +
 
 +
==<b>Design and characterization</b>==
 +
 
 +
The plasmid design of this biological part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. To validate the correctness of DNA sequence, result of Sanger sequencing for <bbpart>BBa_K5133004</bbpart> show the successful assembly among T7 promoter (<bbpart>BBa_K5133000</bbpart>), RBS (<bbpart>BBa_K5133001</bbpart>), sfGFP (this part), and T7 terminator (<bbpart>BBa_K5133003</bbpart>). (<b>Figure 2</b>).
 +
 
 +
 
 +
<center>
 +
<html lang="en">
 +
<head>
 +
    <meta charset="UTF-8">
 +
    <meta name="viewport" content="width=device-width, initial-scale=1.0">
 +
    <title>Resizable Image</title>
 +
    <style>
 +
        .resizable-img1 {
 +
            max-width: 60%;
 +
            height: auto;
 +
        }
 +
    </style>
 +
</head>
 +
<body>
 +
    <img src="https://static.igem.wiki/teams/5133/bba-k5133002-1.jpg"  class="resizable-img1">
 +
</body>
 +
</html>
 +
</center>
 +
 
 +
 
 +
<center><b>Figure 1. Schematic design of this part, generated by SnapGene.</b></center>
 +
 
 +
 
 +
 
 +
 
 +
<center>
 +
<html lang="en">
 +
<head>
 +
    <meta charset="UTF-8">
 +
    <meta name="viewport" content="width=device-width, initial-scale=1.0">
 +
    <title>Resizable Image</title>
 +
    <style>
 +
        .resizable-img2 {
 +
            max-width: 90%;
 +
            height: auto;
 +
        }
 +
    </style>
 +
</head>
 +
<body>
 +
    <img src="https://static.igem.wiki/teams/5133/bba-k5133002-2.jpg"  class="resizable-img2">
 +
</body>
 +
</html>
 +
</center>
 +
 
 +
 
 +
<center><b>Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.</b></center>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
==<b>Usages</b>==
 +
 
 +
This part is used for the construction of composite part <bbpart>BBa_K5133004</bbpart> (sfGFP generator) to demonstrate the feasibility of CFPS in our project.
 +
 
 +
 
 +
 
 +
==<b>DNA sequence (from 5' to 3')</b>==
 +
 
 +
atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt
 +
atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat
 +
gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc
 +
cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag
 +
aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt
 +
attacg<font color="red">tggagccatccgcagttcgaaaaa</font>taa
 +
 
 +
<font color="red">Red font: Strep-Tag II, from pJL1<sup>[1]</sup></font>
 +
 
 +
 
 +
 
 +
==<b>References</b>==
 +
 
 +
[1] Ba, F. et al. Expanding the toolbox of probiotic <i>Escherichia coli</i> Nissle 1917 for synthetic biology. <b>Biotechnology Journal</b> 19, 2300327 (2024). doi: 10.1002/biot.202300327
 +
 
 +
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 08:09, 27 July 2024


Microcin H47

Group: GEC-China (iGEM 2024, team number: #5133)


Brief introduction

This basic part is derived from plasmid pFB399[1], including an DNA sequence for coding Microcin H47, an antimicrobial peptide produced by probiotic E. coli Nissle 1917. By assembling this part with T7 promoter (BBa_K5133000), RBS (BBa_K5133001), and T7 terminator (BBa_K5133003) with iGEM standard backbone pSB1C3, this part is used for the construction of composite part BBa_K5133006 to demonstrate the in vitro production of antimicrobial peptides by CFPS.


Design and characterization

The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. To validate the correctness of DNA sequence, result of Sanger sequencing for BBa_K5133004 show the successful assembly among T7 promoter (BBa_K5133000), RBS (BBa_K5133001), sfGFP (this part), and T7 terminator (BBa_K5133003). (Figure 2).


Resizable Image


Figure 1. Schematic design of this part, generated by SnapGene.



Resizable Image


Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.




Usages

This part is used for the construction of composite part BBa_K5133004 (sfGFP generator) to demonstrate the feasibility of CFPS in our project.


DNA sequence (from 5' to 3')

atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt attacgtggagccatccgcagttcgaaaaataa

Red font: Strep-Tag II, from pJL1[1]


References

[1] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 74
    Illegal PstI site found at 83
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 74
    Illegal PstI site found at 83
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 74
    Illegal PstI site found at 83
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 74
    Illegal PstI site found at 83
  • 1000
    COMPATIBLE WITH RFC[1000]