Difference between revisions of "Part:BBa K4634018"
 
(5 intermediate revisions by the same user not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4634018 short</partinfo>
 
<partinfo>BBa_K4634018 short</partinfo>
−
 
+
{| style="color:black" cellpadding="6" cellspacing="1" border="2" align="right"
 +
! colspan="2" style="background:#00FF00;"|pBV220_PL
 +
|-
 +
|'''Function'''
 +
|Inducible promoter
 +
|-
 +
|'''Chassis Tested'''
 +
|Escherichia coli (bacterial)
 +
|-
 +
|'''Assembly Used'''
 +
|PCR
 +
|-
 +
|'''Abstraction Hierarchy'''
 +
|Part
 +
|-
 +
|'''Backbone'''
 +
|pBV220<br>
 +
|-
 +
|'''Submitted by'''
 +
|[https://2023.igem.wiki/tsinghua Tsinghua iGEM 2023]
 +
|}
 +
<br>
 
Here we hope to optimize PL promoter, enabling a higher expression level at 42 °C. The following content mainly describes the pBV220_PL2 which shows prominent improvement during our experiment. Considering the completeness of the project, the nuclear acid sequence as well as corresponding experimental data of other promoters are also listed below.  
 
Here we hope to optimize PL promoter, enabling a higher expression level at 42 °C. The following content mainly describes the pBV220_PL2 which shows prominent improvement during our experiment. Considering the completeness of the project, the nuclear acid sequence as well as corresponding experimental data of other promoters are also listed below.  
−
 
−
<html>
 
−
 
−
<h2>Characterization</h2>
 
−
 
−
<h3>Introduction</h3>
 
−
 
−
PL and PR promoter, which are ubiquitously employed in bacterial expression systems, are typical promoters regulated by temperature and . In pBV220, they are located tandemly. The repressor, Tcl857, is a temperature sensitive mutant of phage λ. Under normal condition, Tcl857 act as dimers that bind to the OR1, OR2 and OR3 operator site, hindering the occurrence of transcription. When the temperature rises to about 42 °C, the repressor is thus denatured and the transcription happens.[1]
 
−
 
−
<h3>Usage and biology</h3>
 
−
 
−
Compared to PL wild type, the Temperature-sensitive promoter X shows a higher promoter activity after heat treatment.
 
−
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
Line 22: Line 30:
  
 
<!-- -->
 
<!-- -->
−
<span class='h3bb'>Sequence and Features</span>
+
<br><br><br><br><br><br>
 +
===Sequence and Features===
 +
<span class='h3bb'></span>
 
<partinfo>BBa_K4634018 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K4634018 SequenceAndFeatures</partinfo>
  
Line 30: Line 40:
 
<partinfo>BBa_K4634018 parameters</partinfo>
 
<partinfo>BBa_K4634018 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
<html>
 +
 +
<h2>Usage and Biology</h2>
 +
 +
PL and PR promoter, which are ubiquitously employed in bacterial expression systems, are typical promoters regulated by temperature and . In pBV220, they are located tandemly. The repressor, Tcl857, is a temperature sensitive mutant of phage λ. Under normal condition, Tcl857 act as dimers that bind to the OR1, OR2 and OR3 operator site, hindering the occurrence of transcription. When the temperature rises to about 42 °C, the repressor is thus denatured and the transcription happens.[1]
 +
 +
Compared to PL wild type, the Temperature-sensitive promoter 2 (PL-2) shows a higher promoter activity after heat treatment.
 +
 +
<br>
 +
 +
<div class="center">
 +
<p><center><b>Table 1. Predicted optimized PL sequence</b></center></p>
 +
 +
<style type="text/css">
 +
.tg  {border-collapse:collapse;border-spacing:0;}
 +
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
 +
  overflow:hidden;padding:10px 5px;word-break:normal;}
 +
.tg th{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
 +
  font-weight:normal;overflow:hidden;padding:10px 5px;word-break:normal;}
 +
.tg .tg-c3ow{border-color:inherit;text-align:center;vertical-align:top}
 +
.tg .tg-uuae{background-color:#67fd9a;border-color:inherit;text-align:center;vertical-align:top}
 +
.tg .tg-t1ow{background-color:#F5F5F5;border-color:inherit;text-align:center;vertical-align:top}
 +
</style>
 +
<table class="tg">
 +
<thead>
 +
  <tr>
 +
    <th class="tg-uuae">Identifier</th>
 +
    <th class="tg-uuae">Sequence (5’ to 3’)</th>
 +
  </tr>
 +
</thead>
 +
<tbody>
 +
  <tr>
 +
    <td class="tg-t1ow">PL1</td>
 +
    <td class="tg-t1ow">gtaatcacctctgttataccggagatttgttagcctgagcacatcagcagg</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-c3ow">PL2</td>
 +
    <td class="tg-c3ow">gagcccattgcgcctttttggaatacccatgatactgagcacatcagcagg</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-t1ow">PL3</td>
 +
    <td class="tg-t1ow">aatttgcatctacaactccaagtatgaagcggtactgagcacatcagcagg</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-c3ow">PL4</td>
 +
    <td class="tg-c3ow">taacaccagcgggaagttgcctgtgtgcatcgcactgagcacatcagcagg</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-t1ow">PL5</td>
 +
    <td class="tg-t1ow">attatatgccgcacggactctgcggcgcaagatactgagcacatcagcagg</td>
 +
  </tr>
 +
</tbody>
 +
</table>
 +
 +
</div>
 +
<br>
 +
 +
 +
<h3>Experimental Design</h3>
 +
 +
<p>Promoter activity was tested as below: </p>
 +
 +
<p>To test the promoter activity, mCherry gene, which encoded a red fluorescent protein, were ligated downstream. Therefore, the fluorescence intensity would be used as an indicator to reflect the expression level. </p>
 +
 +
<p>Through PCR, The new designed sequence overwrote the PL wild type sequence. And the recombinant plasmids were subsequently transformed into chemically component BL-21 E.coli  strain for expression. This cells were then amplified in liquid LB with ampicillin at 30 °C 220rpm overnight, and were diluted by 100 folds into LB liquid medium and further grown to log phase(OD600=0.4-0.6) the next day. Afterwards, the cells were divided into 7 groups, incubating at different temperature (39°C, 42°C) and heating time (60min, 90min and 120min) as well as a control group were adopted. Then, all bacteria are all placed at 37 °C for 12 hours. After two times of PBS washing, we re-suspend the cells in PBS. OD600 and Fluorescence intensity of mCherry was read and recorded using a plate reader. Promoter activity was reflected from fluorescence divided by OD of bacteria. </p>
 +
 +
<div class="center">
 +
    <div class="thumb tnone">
 +
        <div class="thumbinner" style="width:50%;">
 +
            <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-1.jpg" class="image">
 +
                <img alt="" src="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-1.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 +
                <div class="magnify">
 +
                    <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-1.jpg" class="internal" title="Enlarge"></a>
 +
                </div>
 +
           
 +
               
 +
            </div>
 +
        </div>
 +
    </div>
 +
</div>
 +
 +
<h3>Results</h3>
 +
<p>Firstly, plasmids contains modified PL-promoter were constructed through PCR. During the amplification, The plasmid was divided into two parts (2.2 kb and 2.1 kb respectively) by 2 pairs of primers, and the results of agarose gel electrophoresis were shown below (Fig 1). The right position of sample DNA between makers indicated the success ligation of our PL. </p>
 +
 +
<div class="center">
 +
    <div class="thumb tnone">
 +
        <div class="thumbinner" style="width:50%;">
 +
            <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-2.jpg" class="image">
 +
                <img alt="" src="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-2.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 +
                <div class="magnify">
 +
                    <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-2.jpg" class="internal" title="Enlarge"></a>
 +
                </div>
 +
                <b>Figure 1. PL ligation through PCR.</b>
 +
               
 +
            </div>
 +
        </div>
 +
    </div>
 +
</div>
 +
 +
<p>Then, the products were ligated through infusion, and then transformed into DH-5α E.coli strain to amplify. A colony PCR was also performed (see fig 2), similarly, positive results were observed. </p>
 +
 +
<p>Moreover, the bacteria was also sent to biotechnology company for sequencing, and the returned data also demonstrated the correct construction of the recombinant plasmid. </p>
 +
 +
<div class="center">
 +
    <div class="thumb tnone">
 +
        <div class="thumbinner" style="width:50%;">
 +
            <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-3.jpg" class="image">
 +
                <img alt="" src="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-3.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 +
                <div class="magnify">
 +
                    <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-3.jpg" class="internal" title="Enlarge"></a>
 +
                </div>
 +
                <b>Fig 2. Colony PCR.</b>
 +
               
 +
            </div>
 +
        </div>
 +
    </div>
 +
</div>
 +
 +
<p>After the transformation into BL-21 E.coli strain, we then evaluate the promoter activity. Fig 3A demonstrates the promoter activity between wild type PL and PL-2. Heat treatment was carried under 42 °C for 1.5h. PL-2 exhibited a significant expression fold (41.46x) increasing. Moreover, a mutation of PL-2 (drawn as PL-2*) was observed due to its extremely low promoter activity, which from a side also confirmed that the rational design of our software did work. </p>
 +
 +
<div class="center">
 +
    <div class="thumb tnone">
 +
        <div class="thumbinner" style="width:50%;">
 +
            <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-4.jpg" class="image">
 +
                <img alt="" src="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-4.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 +
                <div class="magnify">
 +
                    <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-4.jpg" class="internal" title="Enlarge"></a>
 +
                </div>
 +
                <b>Fig 3. Relative promoter activity of PL-2. PL-2* indicated the PL-2 promoter with the occurrence of a mutation during cultivation.</b>
 +
               
 +
            </div>
 +
        </div>
 +
    </div>
 +
</div>
 +
 +
<p>The expression level data was illustrated in figure 4.  PL-2 showed stronger expression ability as a whole. The wild type PR possessed a significant activation of the promoter after 42 °C heat treatment, however, for the modified, although a clear trend of expression rising through temperature build-up was still clear, however, CI857, the repressor, seemed to lose its controllability on most modified PL under low temperature. </p>
 +
 +
<div class="center">
 +
    <div class="thumb tnone">
 +
        <div class="thumbinner" style="width:50%;">
 +
            <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-5.jpg" class="image">
 +
                <img alt="" src="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-5.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 +
                <div class="magnify">
 +
                    <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-5.jpg" class="internal" title="Enlarge"></a>
 +
                </div>
 +
                <b>Figure 4, PL-2 characteristics compared to PL wild type. Numbers on top right corner every circle indicates the expression level of PL promoter. A: PL-2, B: PL wild type.</b>
 +
               
 +
            </div>
 +
        </div>
 +
    </div>
 +
</div>
 +
 +
<p>Moreover, the activity under 42°C, 1.5h treatment of the other 4 promoters designed was also tested. Results were shown in table 1 as well as figure 5: </p>
 +
 +
<br>
 +
 +
<div class="center">
 +
<p><center><b>Table 1. Predicted optimized PL sequence</b></center></p>
 +
<style type="text/css">
 +
.tg  {border-collapse:collapse;border-spacing:0;}
 +
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
 +
  overflow:hidden;padding:10px 5px;word-break:normal;}
 +
.tg th{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
 +
  font-weight:normal;overflow:hidden;padding:10px 5px;word-break:normal;}
 +
.tg .tg-baqh{text-align:center;vertical-align:top}
 +
.tg .tg-c3ow{border-color:inherit;text-align:center;vertical-align:top}
 +
.tg .tg-uuae{background-color:#67fd9a;border-color:inherit;text-align:center;vertical-align:top}
 +
.tg .tg-t1ow{background-color:#F5F5F5;border-color:inherit;text-align:center;vertical-align:top}
 +
.tg .tg-jvc7{background-color:#F5F5F5;text-align:center;vertical-align:top}
 +
</style>
 +
<table class="tg">
 +
<thead>
 +
  <tr>
 +
    <th class="tg-uuae">Identifier</th>
 +
    <th class="tg-uuae">Sequence (5’ to 3’)</th>
 +
  </tr>
 +
</thead>
 +
<tbody>
 +
  <tr>
 +
    <td class="tg-t1ow">PL (wild type)</td>
 +
    <td class="tg-t1ow">/</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-t1ow">PL1</td>
 +
    <td class="tg-c3ow">2.07</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-t1ow">PL2</td>
 +
    <td class="tg-t1ow">41.46</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-t1ow">PL3</td>
 +
    <td class="tg-c3ow">0.98</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-t1ow">PL4</td>
 +
    <td class="tg-t1ow">1.36</td>
 +
  </tr>
 +
  <tr>
 +
    <td class="tg-jvc7">PL5</td>
 +
    <td class="tg-baqh">2.75</td>
 +
  </tr>
 +
</tbody>
 +
</table>
 +
 +
</div>
 +
 +
<br>
 +
 +
<div class="center">
 +
    <div class="thumb tnone">
 +
        <div class="thumbinner" style="width:50%;">
 +
            <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-6.jpg" class="image">
 +
                <img alt="" src="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-6.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 +
                <div class="magnify">
 +
                    <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634018-6.jpg" class="internal" title="Enlarge"></a>
 +
                </div>
 +
                <b>Figure 5. Relative activity evaluation. <br>
 +
A: compared to PL wild type, heat treatment was set at 42 Celsius for 1.5 h. <br>
 +
B: compared to PL wild type, continuously under 37 Celsius condition. <br>
 +
</b>
 +
               
 +
            </div>
 +
        </div>
 +
    </div>
 +
</div>
 +
 +
<h3>Discussion and outlook</h3>
 +
<p>Most designed promoter exhibits higher expression level compared to original PL promoter, and the overall increasing validated the effect of our software. Among the promoters, PL-2 stood out as an excellent performed one. </p>
 +
 +
<p>We succeeded in improving the promoter expression under the condition of 42°C, however, almost all promoters exhibited even higher relative activity under 37°C, which lead to our conjecture that the our software weakened the repressor-promoter interaction. This may due to the conditional trigger of PL promoter activity, while in the training set, there were difference characteristics and variance of the promoters which contributed to our software learning. </p>
 +
 +
<h2>References</h2>
 +
[1] Ju, L.W., et al., GeneDn: for high-level expression design of heterologous genes in a prokaryotic system. Bioinformatics (Oxford, England), 1998. 14(10): p. 884-885.
 +
 +
</html>

Latest revision as of 14:06, 12 October 2023


Temperature-sensitive Promoter: pBV220_PL-2, modified from PL promoter.

pBV220_PL
Function Inducible promoter
Chassis Tested Escherichia coli (bacterial)
Assembly Used PCR
Abstraction Hierarchy Part
Backbone pBV220
Submitted by Tsinghua iGEM 2023


Here we hope to optimize PL promoter, enabling a higher expression level at 42 °C. The following content mainly describes the pBV220_PL2 which shows prominent improvement during our experiment. Considering the completeness of the project, the nuclear acid sequence as well as corresponding experimental data of other promoters are also listed below.







Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage and Biology

PL and PR promoter, which are ubiquitously employed in bacterial expression systems, are typical promoters regulated by temperature and . In pBV220, they are located tandemly. The repressor, Tcl857, is a temperature sensitive mutant of phage λ. Under normal condition, Tcl857 act as dimers that bind to the OR1, OR2 and OR3 operator site, hindering the occurrence of transcription. When the temperature rises to about 42 °C, the repressor is thus denatured and the transcription happens.[1] Compared to PL wild type, the Temperature-sensitive promoter 2 (PL-2) shows a higher promoter activity after heat treatment.

Table 1. Predicted optimized PL sequence

Identifier Sequence (5’ to 3’)
PL1 gtaatcacctctgttataccggagatttgttagcctgagcacatcagcagg
PL2 gagcccattgcgcctttttggaatacccatgatactgagcacatcagcagg
PL3 aatttgcatctacaactccaagtatgaagcggtactgagcacatcagcagg
PL4 taacaccagcgggaagttgcctgtgtgcatcgcactgagcacatcagcagg
PL5 attatatgccgcacggactctgcggcgcaagatactgagcacatcagcagg

Experimental Design

Promoter activity was tested as below:

To test the promoter activity, mCherry gene, which encoded a red fluorescent protein, were ligated downstream. Therefore, the fluorescence intensity would be used as an indicator to reflect the expression level.

Through PCR, The new designed sequence overwrote the PL wild type sequence. And the recombinant plasmids were subsequently transformed into chemically component BL-21 E.coli strain for expression. This cells were then amplified in liquid LB with ampicillin at 30 °C 220rpm overnight, and were diluted by 100 folds into LB liquid medium and further grown to log phase(OD600=0.4-0.6) the next day. Afterwards, the cells were divided into 7 groups, incubating at different temperature (39°C, 42°C) and heating time (60min, 90min and 120min) as well as a control group were adopted. Then, all bacteria are all placed at 37 °C for 12 hours. After two times of PBS washing, we re-suspend the cells in PBS. OD600 and Fluorescence intensity of mCherry was read and recorded using a plate reader. Promoter activity was reflected from fluorescence divided by OD of bacteria.

Results

Firstly, plasmids contains modified PL-promoter were constructed through PCR. During the amplification, The plasmid was divided into two parts (2.2 kb and 2.1 kb respectively) by 2 pairs of primers, and the results of agarose gel electrophoresis were shown below (Fig 1). The right position of sample DNA between makers indicated the success ligation of our PL.

Figure 1. PL ligation through PCR.

Then, the products were ligated through infusion, and then transformed into DH-5α E.coli strain to amplify. A colony PCR was also performed (see fig 2), similarly, positive results were observed.

Moreover, the bacteria was also sent to biotechnology company for sequencing, and the returned data also demonstrated the correct construction of the recombinant plasmid.

Fig 2. Colony PCR.

After the transformation into BL-21 E.coli strain, we then evaluate the promoter activity. Fig 3A demonstrates the promoter activity between wild type PL and PL-2. Heat treatment was carried under 42 °C for 1.5h. PL-2 exhibited a significant expression fold (41.46x) increasing. Moreover, a mutation of PL-2 (drawn as PL-2*) was observed due to its extremely low promoter activity, which from a side also confirmed that the rational design of our software did work.

Fig 3. Relative promoter activity of PL-2. PL-2* indicated the PL-2 promoter with the occurrence of a mutation during cultivation.

The expression level data was illustrated in figure 4. PL-2 showed stronger expression ability as a whole. The wild type PR possessed a significant activation of the promoter after 42 °C heat treatment, however, for the modified, although a clear trend of expression rising through temperature build-up was still clear, however, CI857, the repressor, seemed to lose its controllability on most modified PL under low temperature.

Figure 4, PL-2 characteristics compared to PL wild type. Numbers on top right corner every circle indicates the expression level of PL promoter. A: PL-2, B: PL wild type.

Moreover, the activity under 42°C, 1.5h treatment of the other 4 promoters designed was also tested. Results were shown in table 1 as well as figure 5:


Table 1. Predicted optimized PL sequence

Identifier Sequence (5’ to 3’)
PL (wild type) /
PL1 2.07
PL2 41.46
PL3 0.98
PL4 1.36
PL5 2.75

Figure 5. Relative activity evaluation.
A: compared to PL wild type, heat treatment was set at 42 Celsius for 1.5 h.
B: compared to PL wild type, continuously under 37 Celsius condition.

Discussion and outlook

Most designed promoter exhibits higher expression level compared to original PL promoter, and the overall increasing validated the effect of our software. Among the promoters, PL-2 stood out as an excellent performed one.

We succeeded in improving the promoter expression under the condition of 42°C, however, almost all promoters exhibited even higher relative activity under 37°C, which lead to our conjecture that the our software weakened the repressor-promoter interaction. This may due to the conditional trigger of PL promoter activity, while in the training set, there were difference characteristics and variance of the promoters which contributed to our software learning.

References

[1] Ju, L.W., et al., GeneDn: for high-level expression design of heterologous genes in a prokaryotic system. Bioinformatics (Oxford, England), 1998. 14(10): p. 884-885.