Difference between revisions of "Part:BBa K4593006"

(→‎Examining the binding affinity of PA#2/8-A to Protein A)
 
(13 intermediate revisions by the same user not shown)
Line 17: Line 17:
 
====Design of PA#2/8-A ====
 
====Design of PA#2/8-A ====
  
−
We employed a computational approach using the trained BERT language model in a dry lab setting. Through this screening of large amount of aptamer mutants, we discovered this aptamer as effective. We added biotin at the 3’ end to test the affinity of the aptamer
+
We employed a computational approach to truncate the aptamer PA #2/8 in its original length in three aptamer mutants. We added biotin at the 3’ end to test the affinity of the aptamer.
  
−
 
+
<html>
−
Figure 1. The simulated 2D structure of PA#2/8-A
+
<figure>
 +
<p style="text-align:center;"><img src="https://static.igem.wiki/teams/4593/wiki/pcr/design-ap-1.jpg" width="700" height="auto"/>
 +
</figcaption>
 +
</figure>
 +
</html>
 +
                  Figure 1. Secondary structure prediction of the aptamers using mfold program
 +
                            (a) PA#2/8-a, (b) PA#2/8-b, (c) PA#2/8-c
  
 
====Examining the binding affinity of PA#2/8-A to Protein A====
 
====Examining the binding affinity of PA#2/8-A to Protein A====
Line 26: Line 32:
 
We utilized ELONA to verify the binding affinity of PA#2/8 and its truncates to protein A. Table 1 lists the experimental and control groups. The aptamer-only groups were used to exclude background luminescence. The full-length aptamer was used for comparison with the three truncates to determine the optimal aptamer with the highest binding affinity.
 
We utilized ELONA to verify the binding affinity of PA#2/8 and its truncates to protein A. Table 1 lists the experimental and control groups. The aptamer-only groups were used to exclude background luminescence. The full-length aptamer was used for comparison with the three truncates to determine the optimal aptamer with the highest binding affinity.
  
−
Table 1. The experimental and control groups' setting
+
                              Table 1. The experimental and control groups' setting
−
 
+
−
 
+
−
The binding affinity of each truncate was calculated by subtracting the absorbance in reaction to the absorbance in the background (Table 1). The binding affinity of each truncate was then compared in Figure 2. The PA#2/8-C truncate has the strongest binding affinity, and all three truncates have been successfully designed to improve the aptamer-protein binding affinity (Figure 2.)
+
  
 +
<html>
 +
<figure>
 +
<p style="text-align:center;"><img src="https://static.igem.wiki/teams/4593/wiki/result/table-1.png" width="400" height="auto"/>
 +
</figcaption>
 +
</figure>
 +
</html>
  
 +
The binding affinity of each truncate was calculated by subtracting the absorbance in reaction to the absorbance in the background (Table 1). The binding affinity of each truncate was then compared in Figure 2. The relatively binding affinity of PA#2/8-B to protein A is 373.67(Figure 2.)
  
 +
<html>
 +
<figure>
 +
<p style="text-align:center;"><img src="https://static.igem.wiki/teams/4593/wiki/result/figure-25.jpeg" width="400" height="auto"/>
 +
</figcaption>
 +
</figure>
 +
</html>
  
−
Figure 2. The comparison of binding affinity between four aptamers
+
                          Figure 2. The comparison of binding affinity between four aptamers
  
  

Latest revision as of 12:16, 12 October 2023


PA#2/8-A

This part is the DNA sequence of PA#2/8-A

ACCAGCTTATTCAATTAGCAACATG

Usage and Biology

The aptamer is a kind of single-strand DNA that can form the secondary structure and bind with a specific protein. In our project, the Aptamer PA#2/8 is selected to target S. aureus due to its high affinity and specificity with native and recombinant Protein A. This aptamer will be used in vitro to detect the presence of S.aureus.

Team: BNDS-China 2023

Our project aims to create a suite of effective methods for both detecting and lysing S. aureus in vivo. Also, after detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.

Design of PA#2/8-A

We employed a computational approach to truncate the aptamer PA #2/8 in its original length in three aptamer mutants. We added biotin at the 3’ end to test the affinity of the aptamer. 

                  Figure 1. Secondary structure prediction of the aptamers using mfold program
                            (a) PA#2/8-a, (b) PA#2/8-b, (c) PA#2/8-c

Examining the binding affinity of PA#2/8-A to Protein A

We utilized ELONA to verify the binding affinity of PA#2/8 and its truncates to protein A. Table 1 lists the experimental and control groups. The aptamer-only groups were used to exclude background luminescence. The full-length aptamer was used for comparison with the three truncates to determine the optimal aptamer with the highest binding affinity. 

                             Table 1. The experimental and control groups' setting

The binding affinity of each truncate was calculated by subtracting the absorbance in reaction to the absorbance in the background (Table 1). The binding affinity of each truncate was then compared in Figure 2. The relatively binding affinity of PA#2/8-B to protein A is 373.67(Figure 2.) 

                         Figure 2. The comparison of binding affinity between four aptamers


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]