Difference between revisions of "Part:BBa K4814008"
 
(4 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
BBa_I712004 [caagtttgtacaaaaaagcaggctgccacc] BBa_K4814004 [0] BBa_K4814003 [0] BBa_E0020
+
__NOTOC__
 +
<partinfo>BBa_K4814008 short</partinfo>
 +
 
 +
* NOTE: This part is used with <html><a href="https://parts.igem.org/Part:BBa_K4814009">BBa_K4814009 (RPA1-EYFP)</a></html> as a FRET pair.
  
 
FRET is using fluorescent proteins as probes to detect the interaction of targeted proteins. The distance-dependent process transfers energy from an excited molecular fluorophore (the donor) to another fluorophore (the acceptor) through intermolecular long-range dipole–dipole coupling once the desired proteins bind (Sekar, R. B. and Periasamy, A., 2003). The critical Förster radius (typically 3-6 nm) at angstrom distances (10–100 Å) can be calculated to increase the accuracy and ensure precise energy transfer. (Alan Mulllan, n.d.) By using FRET, we can therefore observe the interaction of two proteins by measuring the lifetime of the fluorescent proteins attached to them.
 
FRET is using fluorescent proteins as probes to detect the interaction of targeted proteins. The distance-dependent process transfers energy from an excited molecular fluorophore (the donor) to another fluorophore (the acceptor) through intermolecular long-range dipole–dipole coupling once the desired proteins bind (Sekar, R. B. and Periasamy, A., 2003). The critical Förster radius (typically 3-6 nm) at angstrom distances (10–100 Å) can be calculated to increase the accuracy and ensure precise energy transfer. (Alan Mulllan, n.d.) By using FRET, we can therefore observe the interaction of two proteins by measuring the lifetime of the fluorescent proteins attached to them.
  
 
As the aim of this design is to detect DNA damages in mammalian cells, we have used CMV promoter and the Lentivirus vector. Please refer to BBa_K4814004 and BBa_K4814005 (ATRIP and RPA1) for detailed explanation of the two proteins involved in the DNA damage checkpoint process. ATRIP-CFP is co-infected with RPA1-YFP to conduct FRET.
 
As the aim of this design is to detect DNA damages in mammalian cells, we have used CMV promoter and the Lentivirus vector. Please refer to BBa_K4814004 and BBa_K4814005 (ATRIP and RPA1) for detailed explanation of the two proteins involved in the DNA damage checkpoint process. ATRIP-CFP is co-infected with RPA1-YFP to conduct FRET.
 +
 +
We transfected with ATRIP-ECFP and ATRIP-ECFP + RPA1-YFP (C+Y). However, due to time constraints images of the cells were taken in the six-well plate and the quality was slightly compromised. Nonetheless, these images still provide confirmation that both vectors were successfully transfected into the cells. The CFP fluorescence was excited at 405 nm and the YFP fluorescence was excited at 488 nm.
 +
 +
<html>
 +
<img src="https://static.igem.wiki/teams/4814/wiki/lab/human/c-c-y-location-20230920.png" style="width: 600px;">
 +
<p>Figure 3. The images of ATRIP-ECFP and ATRIP-ECFP + RPA1-EYFP (C+Y) on six-well plate.</p>
 +
</html>
  
 
Sekar, R. B., & Periasamy, A. (2003). Fluorescence resonance energy transfer (FRET) microscopy imaging of live cell protein localizations. The Journal of cell biology, 160(5), 629–633. https://doi.org/10.1083/jcb.200210140
 
Sekar, R. B., & Periasamy, A. (2003). Fluorescence resonance energy transfer (FRET) microscopy imaging of live cell protein localizations. The Journal of cell biology, 160(5), 629–633. https://doi.org/10.1083/jcb.200210140
Line 10: Line 20:
  
 
Yang, T. T., Cheng, L., & Kain, S. R. (1996). Optimized codon usage and chromophore mutations provide enhanced sensitivity with the green fluorescent protein. Nucleic acids research, 24(22), 4592–4593. https://doi.org/10.1093/nar/24.22.4592
 
Yang, T. T., Cheng, L., & Kain, S. R. (1996). Optimized codon usage and chromophore mutations provide enhanced sensitivity with the green fluorescent protein. Nucleic acids research, 24(22), 4592–4593. https://doi.org/10.1093/nar/24.22.4592
 +
 +
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K4814008 SequenceAndFeatures</partinfo>
 +
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K4814008 parameters</partinfo>
 +
<!-- -->

Latest revision as of 10:20, 12 October 2023

ATRIP-ECFP

FRET is using fluorescent proteins as probes to detect the interaction of targeted proteins. The distance-dependent process transfers energy from an excited molecular fluorophore (the donor) to another fluorophore (the acceptor) through intermolecular long-range dipole–dipole coupling once the desired proteins bind (Sekar, R. B. and Periasamy, A., 2003). The critical Förster radius (typically 3-6 nm) at angstrom distances (10–100 Å) can be calculated to increase the accuracy and ensure precise energy transfer. (Alan Mulllan, n.d.) By using FRET, we can therefore observe the interaction of two proteins by measuring the lifetime of the fluorescent proteins attached to them.

As the aim of this design is to detect DNA damages in mammalian cells, we have used CMV promoter and the Lentivirus vector. Please refer to BBa_K4814004 and BBa_K4814005 (ATRIP and RPA1) for detailed explanation of the two proteins involved in the DNA damage checkpoint process. ATRIP-CFP is co-infected with RPA1-YFP to conduct FRET.

We transfected with ATRIP-ECFP and ATRIP-ECFP + RPA1-YFP (C+Y). However, due to time constraints images of the cells were taken in the six-well plate and the quality was slightly compromised. Nonetheless, these images still provide confirmation that both vectors were successfully transfected into the cells. The CFP fluorescence was excited at 405 nm and the YFP fluorescence was excited at 488 nm.

Figure 3. The images of ATRIP-ECFP and ATRIP-ECFP + RPA1-EYFP (C+Y) on six-well plate.

Sekar, R. B., & Periasamy, A. (2003). Fluorescence resonance energy transfer (FRET) microscopy imaging of live cell protein localizations. The Journal of cell biology, 160(5), 629–633. https://doi.org/10.1083/jcb.200210140

Alan Mulllan. (n.d.). Advanced microscopy applications – an overview of FRET. OXFORD instruments. https://andor.oxinst.com/learning/view/article/fret

Yang, T. T., Cheng, L., & Kain, S. R. (1996). Optimized codon usage and chromophore mutations provide enhanced sensitivity with the green fluorescent protein. Nucleic acids research, 24(22), 4592–4593. https://doi.org/10.1093/nar/24.22.4592

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1877
    Illegal BsaI.rc site found at 2065
    Illegal SapI site found at 2889