Difference between revisions of "Part:BBa K4664010"

 
 
Line 17: Line 17:
 
<partinfo>BBa_K4664010 parameters</partinfo>
 
<partinfo>BBa_K4664010 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
===Background===
 +
In order to determine the PLP sequence that yields the best reaction kinetics, we designed padlocks with single, double, and several mismatches at the miRNA binding sites. Padlock probes miR-223-M1-M5（Padlocks M1-M5 ） are single base pair mismatches.
 +
<br>
 +
===Design===
 +
Sequence: <br>TCAATTACACGAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCAACTCAGCTTG<br>
 +
===Results===
 +
The following figure contains results for Padlocks M1-5, in comparison with Padlock-223.
 +
<br>
 +
https://static.igem.wiki/teams/4664/wiki/part/p4640010-1.png
 +
<br>
 +
<i>Figure 1. Padlocks M1-5.</i>
 +
<br>
 +
===References===
 +
Jin, J., Vaud, S., Zhelkovsky, A., Pósfai, J., & McReynolds, L. A. (2016). Sensitive and specific miRNA detection method using SplintR Ligase. Nucleic Acids Research, 44(13), e116. https://doi.org/10.1093/nar/gkw399
 +
<br>
 +
He, Y., Wen, Y., Tian, Z., Hart, N. T., Han, S., Hughes, S. J., & Zeng, Y. (2023b). A one-pot isothermal Cas12-based assay for the sensitive detection of microRNAs. Nature Biomedical Engineering. https://doi.org/10.1038/s41551-023-01033-1

Latest revision as of 07:17, 12 October 2023


Status: 500 Content-type: text/html

Software error:

Not enough arguments for Range::range at /websites/parts.igem.org/cgi/lib/Range.pm line 250, near "range;"
Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_"
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_"
Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288.
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}"
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.


Padlock Padlock-miR-223 is the corresponding padlock chosen for the miR-223 biomarker.

Sequence and Features Status: 500 Content-type: text/html

Software error:

Not enough arguments for Range::range at /websites/parts.igem.org/cgi/lib/Range.pm line 250, near "range;"
Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_"
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_"
Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288.
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}"
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.


Background

In order to determine the PLP sequence that yields the best reaction kinetics, we designed padlocks with single, double, and several mismatches at the miRNA binding sites. Padlock probes miR-223-M1-M5（Padlocks M1-M5 ） are single base pair mismatches.

Design

Sequence:
TCAATTACACGAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCAACTCAGCTTG

Results

The following figure contains results for Padlocks M1-5, in comparison with Padlock-223.
p4640010-1.png
Figure 1. Padlocks M1-5.

References

Jin, J., Vaud, S., Zhelkovsky, A., Pósfai, J., & McReynolds, L. A. (2016). Sensitive and specific miRNA detection method using SplintR Ligase. Nucleic Acids Research, 44(13), e116. https://doi.org/10.1093/nar/gkw399
He, Y., Wen, Y., Tian, Z., Hart, N. T., Han, S., Hughes, S. J., & Zeng, Y. (2023b). A one-pot isothermal Cas12-based assay for the sensitive detection of microRNAs. Nature Biomedical Engineering. https://doi.org/10.1038/s41551-023-01033-1