Difference between revisions of "Part:BBa K4664000"
(One intermediate revision by one other user not shown) | |||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K4664000 short</partinfo> | <partinfo>BBa_K4664000 short</partinfo> | ||
− | + | MiRNA-223 is the biomarker that promotes transforming growth factor (TGF)-β1 expression, and TGF-β1 augments miR-223 expression. It is related to the presence of COPD. | |
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
Line 17: | Line 16: | ||
<partinfo>BBa_K4664000 parameters</partinfo> | <partinfo>BBa_K4664000 parameters</partinfo> | ||
<!-- --> | <!-- --> | ||
+ | ===Background=== | ||
+ | miR-223 promotes TGF (transforming growth factor)- β1 expression, the activated signalling of which is considered to be of great importance in the pathogenesis of emphysema, one of the two pathophysiological branches of COPD. | ||
+ | <br> | ||
+ | miR-223 is significantly upregulated in COPD patients (Roffel et al., 2021). | ||
+ | <br> | ||
+ | RT-qPCR (Reverse Transcription Quantitative Real-time Polymerase Chain Reaction), is a combination of RT-PCR and qPCR methods, and is commonly employed for the detection and quantification of RNA. The procedure involves the enzyme reverse transcriptase converting total RNA or messenger RNA (mRNA) to complementary DNA (cDNA). This cDNA is then amplified and used in quantitative PCR (qPCR) or real-time PCR to detect specific targets. This PCR method utilises a number of fluorescent chemicals to quantify the amount of DNA at each cycle in real-time. | ||
+ | <br> | ||
+ | ===Design=== | ||
+ | miRNA sequence: | ||
+ | <br>CGUGUAUUUGACAAGCUGAGUU | ||
+ | ===Results=== | ||
+ | The following charts show the RT-qPCR results for miR-223. | ||
+ | <br> | ||
+ | https://static.igem.wiki/teams/4664/wiki/part/p464000-1.png | ||
+ | <br> | ||
+ | <i>Figure 1. Results for miR-223 RT-qPCR.</i> | ||
+ | <br> | ||
+ | ===References=== | ||
+ | Roffel, M. P., Maes, T., Brandsma, C., Van Den Berge, M., Vanaudenaerde, B. M., Joos, G., Brusselle, G., Heijink, I. H., & Bracke, K. (2021). MiR-223 is increased in lungs of patients with COPD and modulates cigarette smoke-induced pulmonary inflammation. American Journal of Physiology-lung Cellular and Molecular Physiology, 321(6), L1091–L1104. https://doi.org/10.1152/ajplung.00252.2021 |
Latest revision as of 05:52, 12 October 2023
Status: 500 Content-type: text/html
Software error:
Not enough arguments for Range::range at /websites/parts.igem.org/cgi/lib/Range.pm line 250, near "range;" Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
MiRNA-223 is the biomarker that promotes transforming growth factor (TGF)-β1 expression, and TGF-β1 augments miR-223 expression. It is related to the presence of COPD.
Sequence and Features Status: 500 Content-type: text/html
Software error:
Not enough arguments for Range::range at /websites/parts.igem.org/cgi/lib/Range.pm line 250, near "range;" Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Background
miR-223 promotes TGF (transforming growth factor)- β1 expression, the activated signalling of which is considered to be of great importance in the pathogenesis of emphysema, one of the two pathophysiological branches of COPD.
miR-223 is significantly upregulated in COPD patients (Roffel et al., 2021).
RT-qPCR (Reverse Transcription Quantitative Real-time Polymerase Chain Reaction), is a combination of RT-PCR and qPCR methods, and is commonly employed for the detection and quantification of RNA. The procedure involves the enzyme reverse transcriptase converting total RNA or messenger RNA (mRNA) to complementary DNA (cDNA). This cDNA is then amplified and used in quantitative PCR (qPCR) or real-time PCR to detect specific targets. This PCR method utilises a number of fluorescent chemicals to quantify the amount of DNA at each cycle in real-time.
Design
miRNA sequence:
CGUGUAUUUGACAAGCUGAGUU
Results
The following charts show the RT-qPCR results for miR-223.
Figure 1. Results for miR-223 RT-qPCR.
References
Roffel, M. P., Maes, T., Brandsma, C., Van Den Berge, M., Vanaudenaerde, B. M., Joos, G., Brusselle, G., Heijink, I. H., & Bracke, K. (2021). MiR-223 is increased in lungs of patients with COPD and modulates cigarette smoke-induced pulmonary inflammation. American Journal of Physiology-lung Cellular and Molecular Physiology, 321(6), L1091–L1104. https://doi.org/10.1152/ajplung.00252.2021