Difference between revisions of "Part:BBa K4814007"

Revision as of 01:39, 12 October 2023

RPA1-mCherry

FRET is using fluorescent proteins as probes to detect the interaction of targeted proteins. The distance-dependent process transfers energy from an excited molecular fluorophore (the donor) to another fluorophore (the acceptor) through intermolecular long-range dipole–dipole coupling once the desired proteins bind (Sekar, R. B. and Periasamy, A., 2003). The critical Förster radius (typically 3-6 nm) at angstrom distances (10–100 Å) can be calculated to increase the accuracy and ensure precise energy transfer. (Alan Mulllan, n.d.) By using FRET, we can therefore observe the interaction of two proteins by measuring the lifetime of the fluorescent proteins attached to them.

As the aim of this design is to detect DNA damages in mammalian cells, we have used CMV promoter and the Lentivirus vector. Please refer to BBa_K4814004 and BBa_K4814005 (ATRIP and RPA1) for detailed explanation of the two proteins involved in the DNA damage checkpoint process.

The mCherry is derived from https://www.snapgene.com/plasmids/fluorescent_protein_genes_and_plasmids/mCherry (same as BBa_K4814011), a mammalian codon optimized mCherry.

FRET results

After subjecting the cells to UVB treatment at a dosage of 100 J/m^2, we observed a change in the density of both EGFP and mCherry signals. When excited at 488 nm, we noticed that the EGFP signal became weaker following exposure to UVB. However, in contrast, the red fluorescence emitted by mCherry (with an emission range of 570-620 nm) intensified.

Figure 3. The image of ATRIP-EGFP (excited at 488 nm) + RPA1-mCherry (RPA1-mCherry transfected twice) (excited at 561 nm).

To enhance the accuracy and reliability of our data analysis, we utilized ImageJ software to precisely outline the cell nuclei present in the Green Channel (excited at 488 nm). This step ensured that we specifically selected cells that were transfected with EGFP, as depicted in Figure . We focused on GFP-emitting cells because we observed that the image captured in the 488 nm excited green channel did not completely overlap with the image in the 488 nm excited red channel.

However, it is important to note that the 488 nm red channel fluorescence should correspond to GFP emission at approximately 560 nm. Therefore, the shape of the cells in the red channel should be identical to that in the green channel (as shown in Figure .). By choosing GFP-emitting cells, we aimed to reduce background noise and focus our analysis specifically on the G+M cells (cells expressing both ATRIP-EGFP and RPA1-mCherry), excluding cells expressing only RPA1-mCherry.

Statistical Analysis

To handle the non-linear nature of the data, we took the logarithm of the values with a base of 2, which brings the values onto a comparable scale.

In Figure 4, the data points in the UV- graph are divided into two groups, with a separation occurring at 0.1. We set this value as the cutoff point, indicating the presence of FRET when the data point exceeds 0.1.

In the UV+ graph, there is a noticeable distinction in the proportion of data points indicating FRET.

Figure 4. Distribution of the Log base 2 Red/Green data before and after UV.

The Red over Green ratio (Log_2) showed an increase of more than threefold after UVB light treatment. This substantial increase indicates that there is energy transfer from GFP to mCherry, resulting in the emission of red fluorescence when exposed to UV light. This confirms the occurrence of FRET energy transfer.

To assess the significance of the relationship between the two categorical variables, we employed Fisher's exact test. This statistical test is suitable when dealing with small cell counts. When the two-sided p-value is less than 0.01, it suggests a significant association between the two groups. (MedCalc Software Ltd. Fisher, 2023)

The result of Fisher's exact test revealed a strong significance between the two groups (p-value = 0.00122178, p-value < 0.01), indicating a stastical significance.

Figure 5. The Mean Log base 2 of Red over Green ratio with standard error before and after UV. Technical sample number = 4 with about 30 data points in each sample.

Sekar, R. B., & Periasamy, A. (2003). Fluorescence resonance energy transfer (FRET) microscopy imaging of live cell protein localizations. The Journal of cell biology, 160(5), 629–633. https://doi.org/10.1083/jcb.200210140

Alan Mulllan. (n.d.). Advanced microscopy applications – an overview of FRET. OXFORD instruments. https://andor.oxinst.com/learning/view/article/fret

• caagtttgtacaaaaaagcaggctgccacc contains Kozak (gccacc)

Sequence and Features