Difference between revisions of "Part:BBa K4768001"
 
(10 intermediate revisions by 2 users not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4768001 short</partinfo>
 
<partinfo>BBa_K4768001 short</partinfo>
 +
 +
<i>sfGFP</i>  gene under control of a T7 promoter with an operator site known as <i>dhdO</i> for expression in PURE system.
 +
 +
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===
 +
 +
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
−
<partinfo>BBa_K4768001 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4768004 SequenceAndFeatures</partinfo>
−
<p>xxxxxxxxxxxxxxxxxxadd part imagexxxxxxxxxxxxx</p>
+
 
 +
 
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K4768004 parameters</partinfo>
 +
<!-- -->
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>TXXXXXX.</p>
+
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:60%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/parts/part-001.png">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 0:</b> <i>dhdO_sfgfp</i> part </i>
 +
</span></figcaption>
 +
        </figure>
 +
</div>
 +
 
 +
<p>The CALIPSO part BBa_K4768001 is composed of a <i>superfolder gfp</i> gene under the control of DhdR operator site, <i>dhdO</i>. Additionally, the presence of a T7 promoter and terminator allows its expression in PURE system.</p>
 +
<p>This part can be used as a reporter gene to test a biosensor system that relies on the affinity between 2-Hydroxyglutarate (2-HG), an oncometabolite, and DhdR protein. Repression of the <i>sfgfp</i> gene by DhdRis released in the presence of 2-HG. This part is used in our project to validate our biosensor system, which includes the oncometabolite 2-HG, the DhdR protein as a gene repressor, and the  <i>dhdO </i> sequence as an operator site.</p>
 +
<p>DhdR is a transcriptional repression factor isolated from the bacteria Achromobacter denitrificans. It is described in the part BBa_K4768000.</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:60%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/registry/gfp-part/sch-ma-gfp-biosenseur.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: Operating principle of our biosensor.</b> In the presence of 2-HG, repression is removed and the gene is expressed leading to the production of the superfolder gfp. </i></span></figcaption>
 +
        </figure>
 +
</div>
 +
 
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>TXXXXXX.</p>
+
<p>The <i>sfgfp</i> gene was inserted downstream a T7 promoter with an operator site <i>dhdO</i>, described above. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.</p>
 +
<p>We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):
 +
<ul>
 +
    <li>T7term-F: AGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCC</li>
 +
    <li> T7term-R: GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG</li>
 +
</ul>
 +
</P>
  
−
<h2>Molecular Modeling</h2>
+
 
−
<p>TXXXXXX.</p>
+
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:60%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/experiments/cloning/pet21-sfgfp-italique.png">  
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 2: Construction of the plasmid pET21_sfgfp.</b> (A) Agarose gel electrophoresis  of the PCR products generated from the gBlock and pET21 plasmid. 0.8% agarose and EtBr staining were used. (B) Positive clones were identified from the colony PCR screening. T+ and T- refer to positive control (gBlock amplification) and negative control (without DNA matrix), respectively. (C) Double and single-enzymatic digestion of the pET21_sfgfp derived from clone 8 by EcoRV and XhoI (Simulated (left) and experimental (right) patterns).</i></span></figcaption>
 +
        </figure>
 +
</div>
 +
<p>Cloning was successful and two plasmids from positive clones (8) was sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation. </P>
  
 
<h2>Characterisation</h2>
 
<h2>Characterisation</h2>
−
<p>TXXXXXX.</p>
+
<h3>Cell-free production of sfGFP</h3>
 +
 
 +
<p>We used the PCR products of <i>tymp, sfgfp</i>, and <i>anti-HER2 nanobody (anti-HER2-nb)</i> as templates for expression with the PURE<I>frex</I> 2.0 kit (See the protocol <a href="https://2023.igem.wiki/toulouse-insa-ups/protocols" target="blank">here</a>). Additionally, we supplemented the reaction with GreenLys reagent for the co-translational incorporation of fluorescent lysine residues, which facilitated the detection of synthesized proteins by SDS-PAGE.</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:60%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/registry/gfp-part/gfp-fig-3.png">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 3: SDS-PAGE analysis of the gene expression products (Mini-PROTEAN TGX Stain-free Gels).</b> The  overlay of the GreenLys and stain-free images are shown. Lanes from left to right: negative control without DNA, positive control with <i>dhfr </i>control plasmid, <i>TYMP</i> with an expected size of 52 kDa, <i>sfGFP</i> with an expected size of 26 kDa, <i>anti-HER2-nb</i> with an expected size of 17 kDa, protein ladder.</i></span></figcaption>
 +
        </figure>
 +
</div>
 +
<p>The presence of the sfGFP protein at the expected molecular weight was visible in lane 4 (Figure 3). This result confirms the successful production of GFP protein in PURE system under non-repressed conditions.</p>
 +
 
 +
<h3>Inhibition of transcription of the <i> sfgfp</i> gene by the DhdR repressor</h3>
 +
<p>The aim of the experiments was to establish that the binding of the repressor DhdR to its operator site, <i>dhdO</i>, effectively inhibits transcription of a gene of interest regulated by <i>dhdO</i>. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system.</p>
 +
 
 +
<p>Inhibition was tested on the <i>sfgfp</i> reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. The biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/dhdr-results-2.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 5: Effect of different concentrations of DhdR on the expression of a fluorescent reporter gene.</b> Experiments 1 and 2 were performed with the same batch of PCR product from clone 8, while a new batch of PCR product from the same clone was used in experiment 3. PUREfrex2.0 was used in all conditions. The intensity value of sfGFP without DhdR was used for normalization. Excitation and emission wavelengths were 488 nm and 510 nm, respectively.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div>
 +
 
 +
<p>As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 5). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a <i>dhdO</i> operator sequence  was 1.5 µM, validating the predictions of the biochemical network model.</p>
 +
 
 +
<p>Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 6). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/dhdr-results-4.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 6: Effect of different concentrations of 2-HG on DhdR repression.</b> PUREfrex2.1 was used. The intensity value of sfGFP without DhdR and with 10 µM 2-HG was used for normalization. Each concentration was corrected taking into account the inactivation effect of 2-HG on PURE system.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div>
 +
 
 +
<h3> In-liposome expression of the <i>sfgfp</i> gene</h3>
 +
<ul>
 +
    <li><b> DhdR repression in liposomes</b></li>
 +
<p>Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the <i>sfgfp</i> gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.</p>
 +
<p>Figure 7a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 7b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (Fig. 7c).</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/microscope-1.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figures 7:</b> a) Liposomes were localized with a fluorescent membrane dye. b) Zoom-in image of the liposome area depicted with a red arrow in a. A yellow line crossing the liposome has been appended. c) Fluorescence intensity profile along the line appended in b. The two peaks correspond to the two regions of membrane crossing.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div> 
 +
 
 +
<p>Figure 8a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 8b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 8c. Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes. </p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/microscope-2.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figures 8: Fluorescence microscopy image of  liposomes in the GFP channel.</b> Expressed sfGFP signal was localized in the liposome lumen. a) Large field-of-view. b) Blow-up of the liposome depicted with the red arrow in a. c) Intensity profile along the yellow line appended in b.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div> 
 +
 
 +
    <li><b> Liposomes are capable of expressing GFP in the presence of living cancer cells</b></li>
 +
 
 +
<p>Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the <i>sfgfp</i> gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated in a thermocycler for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for <i>in situ</i> gene expression (sample 2). The latter protocol more closely mimics the <i>in vivo</i> conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.
 +
 
 +
<p>In sample 1, in the field of view displayed in Figures 9, two liposomes were localized using the fluorescent membrane dye (Fig. 9b) but only one exhibits sfGFP signal (Fig. 9c).</p>
 +
 
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/best-measurement/figure4bis.png">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figures 9: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 1).</b> a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of liposomes localized with a fluorescent membrane dye. c) Imaging of liposomes in the GFP channel.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div> 
 +
 
 +
<p>Similar results were obtained with sample 2, as shown in Figures 10.</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/registry/part-dhdr-fig-9.png">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figures 10: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 2).</b>a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of a liposome localized with a fluorescent membrane dye. c) Imaging of the same liposome in the GFP channel.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div> 
 +
 
 +
<p>No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.</p>
 +
 
 +
</ul>
 +
 
  
−
<h2>Conclusion and Perspectives</h2>
+
<h2>Conclusion </h2>
−
<p>TXXXXXX.</p>
+
<p>These experiments provide evidence that this part can be used as a reporter gene to test the 2-HG biosensor. We have also established that this part can be used as a reporter in bulk assays and within liposomes in a tumoral environment containing physiological levels of 2-HG.</p>
  
 
<h2>References</h2>
 
<h2>References</h2>
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>article 1 xxxxxxxx</li>
+
     <li><sup>[1]</sup>Xiao, D., Zhang, W., Guo, W., Liu, Y., Hu, C., Guo, S., Kang, Z., Xu, X., Ma, C., Gao, C., & Xu, P. 2021. A D-2-hydroxyglutarate biosensor based on  specific transcriptional regulator DhdR. Nature Communications 12, 7108. </li>
−
     <li>article 2 xxxxxxx</li>
+
     <li><sup>[2]</sup>Jezek, P. 2020. 2-Hydroxyglutarate in Cancer Cells. Antioxid Redox Signal, 33(13),903-926.</li>
 
</i>
 
</i>
 
</ol>
 
</ol>
 
</html>
 
</html>

Latest revision as of 16:51, 10 October 2023


dhdO_sfgfp

sfGFP gene under control of a T7 promoter with an operator site known as dhdO for expression in PURE system.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Introduction

Figure 0: dhdO_sfgfp part

The CALIPSO part BBa_K4768001 is composed of a superfolder gfp gene under the control of DhdR operator site, dhdO. Additionally, the presence of a T7 promoter and terminator allows its expression in PURE system.

This part can be used as a reporter gene to test a biosensor system that relies on the affinity between 2-Hydroxyglutarate (2-HG), an oncometabolite, and DhdR protein. Repression of the sfgfp gene by DhdRis released in the presence of 2-HG. This part is used in our project to validate our biosensor system, which includes the oncometabolite 2-HG, the DhdR protein as a gene repressor, and the dhdO sequence as an operator site.

DhdR is a transcriptional repression factor isolated from the bacteria Achromobacter denitrificans. It is described in the part BBa_K4768000.

Figure 1: Operating principle of our biosensor. In the presence of 2-HG, repression is removed and the gene is expressed leading to the production of the superfolder gfp.

Construction

The sfgfp gene was inserted downstream a T7 promoter with an operator site dhdO, described above. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.

We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):

  • T7term-F: AGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCC
  • T7term-R: GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG

Figure 2: Construction of the plasmid pET21_sfgfp. (A) Agarose gel electrophoresis of the PCR products generated from the gBlock and pET21 plasmid. 0.8% agarose and EtBr staining were used. (B) Positive clones were identified from the colony PCR screening. T+ and T- refer to positive control (gBlock amplification) and negative control (without DNA matrix), respectively. (C) Double and single-enzymatic digestion of the pET21_sfgfp derived from clone 8 by EcoRV and XhoI (Simulated (left) and experimental (right) patterns).

Cloning was successful and two plasmids from positive clones (8) was sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation.

Characterisation

Cell-free production of sfGFP

We used the PCR products of tymp, sfgfp, and anti-HER2 nanobody (anti-HER2-nb) as templates for expression with the PUREfrex 2.0 kit (See the protocol here). Additionally, we supplemented the reaction with GreenLys reagent for the co-translational incorporation of fluorescent lysine residues, which facilitated the detection of synthesized proteins by SDS-PAGE.

Figure 3: SDS-PAGE analysis of the gene expression products (Mini-PROTEAN TGX Stain-free Gels). The overlay of the GreenLys and stain-free images are shown. Lanes from left to right: negative control without DNA, positive control with dhfr control plasmid, TYMP with an expected size of 52 kDa, sfGFP with an expected size of 26 kDa, anti-HER2-nb with an expected size of 17 kDa, protein ladder.

The presence of the sfGFP protein at the expected molecular weight was visible in lane 4 (Figure 3). This result confirms the successful production of GFP protein in PURE system under non-repressed conditions.

Inhibition of transcription of the sfgfp gene by the DhdR repressor

The aim of the experiments was to establish that the binding of the repressor DhdR to its operator site, dhdO, effectively inhibits transcription of a gene of interest regulated by dhdO. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system.

Inhibition was tested on the sfgfp reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. The biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.

Figure 5: Effect of different concentrations of DhdR on the expression of a fluorescent reporter gene. Experiments 1 and 2 were performed with the same batch of PCR product from clone 8, while a new batch of PCR product from the same clone was used in experiment 3. PUREfrex2.0 was used in all conditions. The intensity value of sfGFP without DhdR was used for normalization. Excitation and emission wavelengths were 488 nm and 510 nm, respectively.

As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 5). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a dhdO operator sequence was 1.5 µM, validating the predictions of the biochemical network model.

Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 6). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.

Figure 6: Effect of different concentrations of 2-HG on DhdR repression. PUREfrex2.1 was used. The intensity value of sfGFP without DhdR and with 10 µM 2-HG was used for normalization. Each concentration was corrected taking into account the inactivation effect of 2-HG on PURE system.

In-liposome expression of the sfgfp gene

  • DhdR repression in liposomes

    • Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.

    Figure 7a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 7b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (Fig. 7c).

    Figures 7: a) Liposomes were localized with a fluorescent membrane dye. b) Zoom-in image of the liposome area depicted with a red arrow in a. A yellow line crossing the liposome has been appended. c) Fluorescence intensity profile along the line appended in b. The two peaks correspond to the two regions of membrane crossing.

    Figure 8a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 8b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 8c. Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes.

    Figures 8: Fluorescence microscopy image of liposomes in the GFP channel. Expressed sfGFP signal was localized in the liposome lumen. a) Large field-of-view. b) Blow-up of the liposome depicted with the red arrow in a. c) Intensity profile along the yellow line appended in b.
  • Liposomes are capable of expressing GFP in the presence of living cancer cells

    • Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated in a thermocycler for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for in situ gene expression (sample 2). The latter protocol more closely mimics the in vivo conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.

    In sample 1, in the field of view displayed in Figures 9, two liposomes were localized using the fluorescent membrane dye (Fig. 9b) but only one exhibits sfGFP signal (Fig. 9c).

    Figures 9: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 1). a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of liposomes localized with a fluorescent membrane dye. c) Imaging of liposomes in the GFP channel.

    Similar results were obtained with sample 2, as shown in Figures 10.

    Figures 10: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 2).a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of a liposome localized with a fluorescent membrane dye. c) Imaging of the same liposome in the GFP channel.

    No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.

Conclusion

These experiments provide evidence that this part can be used as a reporter gene to test the 2-HG biosensor. We have also established that this part can be used as a reporter in bulk assays and within liposomes in a tumoral environment containing physiological levels of 2-HG.

References

  1. [1]Xiao, D., Zhang, W., Guo, W., Liu, Y., Hu, C., Guo, S., Kang, Z., Xu, X., Ma, C., Gao, C., & Xu, P. 2021. A D-2-hydroxyglutarate biosensor based on specific transcriptional regulator DhdR. Nature Communications 12, 7108.
  2. [2]Jezek, P. 2020. 2-Hydroxyglutarate in Cancer Cells. Antioxid Redox Signal, 33(13),903-926.
    3.