Difference between revisions of "Part:BBa K4768001"
 
(11 intermediate revisions by 2 users not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4768001 short</partinfo>
 
<partinfo>BBa_K4768001 short</partinfo>
 +
 +
<i>sfGFP</i>  gene under control of a T7 promoter with an operator site known as <i>dhdO</i> for expression in PURE system.
 +
 +
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===
 +
 +
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
−
<partinfo>BBa_K2668010 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4768004 SequenceAndFeatures</partinfo>
  
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K4768004 parameters</partinfo>
 +
<!-- -->
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>XXXXXXXXXXXXXXXXXXCXXXXXXXXX</p>
+
<div align="center">
−
<h2>Construction</h2>
+
        <figure class="normal mx-auto">   
−
<p>XXXXXXXXXXXXXXXXXXXXXXXXXX</p>
+
            <img class="d-block"
−
   
+
            style="width:60%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/parts/part-001.png">  
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 0:</b> <i>dhdO_sfgfp</i> part </i>
 +
</span></figcaption>
 +
        </figure>
 +
</div>
  
 +
<p>The CALIPSO part BBa_K4768001 is composed of a <i>superfolder gfp</i> gene under the control of DhdR operator site, <i>dhdO</i>. Additionally, the presence of a T7 promoter and terminator allows its expression in PURE system.</p>
 +
<p>This part can be used as a reporter gene to test a biosensor system that relies on the affinity between 2-Hydroxyglutarate (2-HG), an oncometabolite, and DhdR protein. Repression of the <i>sfgfp</i> gene by DhdRis released in the presence of 2-HG. This part is used in our project to validate our biosensor system, which includes the oncometabolite 2-HG, the DhdR protein as a gene repressor, and the  <i>dhdO </i> sequence as an operator site.</p>
 +
<p>DhdR is a transcriptional repression factor isolated from the bacteria Achromobacter denitrificans. It is described in the part BBa_K4768000.</p>
  
−
<div class="center">
+
<div align="center">
−
         <div class="thumb tnone">
+
         <figure class="normal mx-auto">  
−
             <div class="thumbinner" style="width:50%;">
+
             <img class="d-block"
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
+
             style="width:60%;"
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
             src="https://static.igem.wiki/teams/4768/wiki/registry/gfp-part/sch-ma-gfp-biosenseur.jpg">  
−
                    <div class="magnify">
+
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: Operating principle of our biosensor.</b> In the presence of 2-HG, repression is removed and the gene is expressed leading to the production of the superfolder gfp. </i></span></figcaption>
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
+
         </figure>
−
                    </div>
+
−
                    <b>Figure 1: </b> <b>Analyses of pSB1C3_ CBM3- monomeric streptavidin – AzF length and restriction map</b> 
+
−
                    The plasmids of 5 obtained clones were analysed to check their length. XbaI/NcoI digested plasmids (clones 1 to 5) are electrophoresed through a 1% agarose gel. Lane 1 is the Smart DNA ladder (Eurogentec), the 0.4kb, 1.5 kb and 3kb DNA fragments are annotated. Lane 2 to  6 are the digested plasmids resulting from DNA extraction of the 5 clones.
+
−
                </div>
+
−
             </div>
+
−
        </div>
+
−
    </div>
+
−
<h2>Molecular Modeling</h2>
+
−
<p>Modelling this three-headed fusion protein presented a complex challenge, requiring a multi-step and multi-level strategy relying on various molecular modelling and simulation methods. We used available X-ray structure data from the Protein Data Bank, integrated 3D structure prediction tools, employed innovative robotics inspired artificial intelligence methods to explore the intrinsically disordered regions, built and parametrised the unnatural amino acid aziodphenyalanine, and finally studied its behaviour over time through molecular dynamics simulations in a large explicit solvent water box. The results of the molecular dynamics simulation comforted us in the stability of our construction as the domains kept their structure over 90ns of simulation as showed in figure 2.</p>
+
−
<div class="center">
+
−
    <div class="thumb tnone">
+
−
        <div class="thumbinner" style="width:80%;">
+
−
             <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
+
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                <div class="magnify">
+
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
+
−
                </div>
+
−
                <b>Figure 2: </b> <b>Molecular Dynamics simulation of Cerberus in a water box (not showed) for 90ns  </b>
+
−
                In Red streptavidin, in orange the TEV Cleavage site, in yellow the endogenous <em>N</em>-terminus linker, in green the CBM3a, in light blue the endogenous <em>C</em>-terminus linker, in magenta the biotin and in blue the FITC clicked on the AzF.
+
−
            </div>
+
−
         </div>
+
−
    </div>
+
 
</div>
 
</div>
−
   
+
 
−
<h2>Characterisation</h2>
+
 
−
<h3>Production of Cerberus</h3>
+
<h2>Construction</h2>
−
<p>The fusion between the streptavidin linker and CBM3a platform sequences followed by the amber stop codon was cloned into the pET28 (containing an His Tag) expression vector using In-Fusion Cloning Kit. pET28 was digested by NcoI and HindIII and the part was amplified using the primer pairs stated below. The resulting construct was co-transformed along the pEVOL-AzF expression vector (coding for amino acyl tRNA synthetase (aarS)/tRNA orthogonal pair for <i>in vivo</i> incorporation in <em>E. coli</em> under L-arabinose induction) into <i>E. coli</i> strain BL21. pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid # 31186). Expression of the recombinant protein was induced using IPTG and L-arabinose, with addition of AzF in the medium. The synthesis of aaRS/tRNA pair was first induced with L-arabinose and AzF added at the same time. One hour later, the production of Cerberus was triggered with IPTG. The His-tagged protein was then purified on IMAC resin (Sigma) charged with cobalt. Results are shown on figure 3.</p>
+
<p>The <i>sfgfp</i> gene was inserted downstream a T7 promoter with an operator site <i>dhdO</i>, described above. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.</p>
−
<p>Primer used to clone this part in the pET28: (from 5' to 3')</p>
+
<p>We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):
−
<ul>
+
−
    <li>Cerberus_pET_Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
+
−
    <li>Cerberus_pET_Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
−
<p>Primer used to clone this part in the pSB1C3: (from 5' to 3')</p>
+
 
<ul>
 
<ul>
−
     <li>Cerberus_pSB1C3_Forward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
+
     <li>T7term-F: AGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCC</li>
−
     <li>Cerberus_pSB1C3_Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
+
     <li> T7term-R: GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG</li>
 
</ul>
 
</ul>
−
<div class="center">
+
</P>
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" class="image">
+
−
                    <img alt="" src="/wiki/images/5/57/T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 3: </b> <b>SDS-PAGE analysis of the production of Cerberus </b> 
+
−
                    NI: non-induced, I-AzF: induced without AzF, I+AzF: induced with AzF, E1: elution with 40 mM imidazole, E2: elution with 100 mM imidazole, E3: elution with 100 mM imidazole, MW: molecular weight ladder
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<p>Induction in the presence  of AzF (lane I+AzF) led to the expression of two major bands at 37 and 39 kDa approximately compared to control conditions, namely the non-induced (lane NI) and induced without AzF (lane I-AzF). We hypothesized that the upper and the lower bands could correspond to Cerberus (expected molecular weight of monomeric Cerberus: 41 kDa), and a version of Cerberus lacking AzF and therefore the His Tag (39kDa expected). Surprisingly, both bands were still present in the elution fractions which seems incoherent since the band lacking the His-tag was supposed to be washed out during purification steps. To confirm our hypothesis, we analysed the same fractions by western blot using antibodies directed against the His-tag (Figure 4)</p>
+
−
<div class="center">
+
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" class="image">
+
−
                    <img alt="" src="/wiki/images/d/dc/T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 4: </b> <b>Western Blot with anti His tag antibodies of Cerberus production </b> 
+
−
                    NI: non-induced, I-AzF: induced without AzF, I+AzF: induced with AzF, E: elution, MW: molecular weight ladder, Ctrl N-ter: Control protein with an <em>N</em>-terminus His Tag, Ctrl C-ter: Control protein with an <em>C</em>-terminus His Tag.
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<p>Anti-His-tag antibodies revealed a band at about 45 kDa in the sample corresponding to IPTG induction in the presence of AzF (lane I+AzF). This band is not present in control samples (lane NI and I-AzF), indicating that it corresponds to the Cerberus protein (theoretical size: 41 kDa). In addition to the full length protein, we observed several extra bands which very likely correspond to proteolysis products since they are detected with the anti-His-tag antibodies. Moreover, the band at 45 kDa is clearly detected in elution samples (lanes E). The purification level of Cerberus with monomeric streptavidin in the elution samples was estimated about 62%. These data show that Cerberus was efficiently purified and can be used for subsequent assays. In addition, these results show that experimental setup to produce Cerberus also leads to the production of a protein where the amber stop codon has not been recognized by the AzF-charged orthogonal tRNA (a construction we named Orthos in our project). Although Orthos does not contain a His-tag at its C-terminus, the protein seems to be efficiently co-purified with Cerberus. The basis of this observation is unclear but this result may suggest that Orthos and Cerberus interact together.</p>
+
−
<h3>Validation of Cerberus</h3>
+
−
    <h4>Validation of the AzF and CBM3a heads using FITC (Fluorescein isothiocyanate) molecules</h4>
+
−
<p>To validate both the AzF and CBM3a heads of Cerberus, we challenged its potential to functionalize cellulose with fluorescence. To generate a fluorescently labelled Cerberus protein, we first performed a SPAAC reaction on 3.2 µM Cerberus protein using 31.9 µM of FITC-DBCO (Jena Bioscience). In the control experiment, 31.9 µM of FITC alone was used. These samples were then incubated with cellulose for 16 hours and after several washes with resuspension buffer (50mM Tris HCl pH 8), fluorescence levels were measured in the cellulose pellet fractions (Figure 5). We observed that the fluorescence levels in the cellulose pellet incubated with Cerberus protein clicked to FITC were about 3 times higher than in the control experiments corresponding to the cellulose pellet incubated with FITC alone. These results show that Cerberus can efficiently be conjugated with fluorescent molecules bearing a DBCO group by click chemistry and that the resulting fluorescent molecules strongly interact with cellulose.This result proves that cerberus AzF and CBM3a heads are valid and therefore, makes our construction both a practical and potent platform to functionalize cellulose.</p>
+
−
<div class="center">
+
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" class="image">
+
−
                    <img alt="" src="/wiki/images/e/e2/T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 5: </b> <b>Fluorescence remaining in cellulose fraction after several washes  </b> 
+
−
                    Experiment were performed in quadruplicate test in 50 mM Tris HCl pH 8 using 100&mu;L of 10mg/ml Regenerated Amorphous Cellulose and 100&mu;L of click reaction. Samples were incubated for 30 minutes, centrifugated, supernatant discarted and resuspended in Tris HCl four times , *Mann Whitney test p-value 0.03 computed using R 3.4.2.
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<h4>Validation of the Streptavidin and CBM3a heads</h4>
+
−
<p>To asses the functionality of the Streptavidin head, we used a non AzF version of Cerberus (its Orthos version). We performed SPAAC reaction to ligate <em>in vitro</em> biotin-DBCO to an azide-functionalized fluorescein (FITC), thus leading to the expected biotinylated FITC. 5.8 &mu;M of Orthos were incubated with 58.0 &mu;M of biotinylated FITC for one hour under shaking and then incubated with regenerated amorphous cellulose as described previously. Fluorescence was measured after four washes and results are presented in figure 6.</p>
+
−
<div class="center">
+
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Collaborations--angeline--FluoRetainedOrthos2.jpg" class="image">
+
−
                    <img alt="" src="https://static.igem.org/mediawiki/2018/5/52/T--Toulouse-INSA-UPS--Collaborations--angeline--FluoRetainedOrthos2.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Collaborations--angeline--FluoRetainedOrthos2.jpg" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 6: </b> <b>Fluorescence remaining in cellulose fraction after several washes  </b> 
+
−
                    Experiment were performed in quadruplicate test in 50 mM Tris HCl pH 8 using 100&mu;L of 10mg/ml Regenerated Amorphous Cellulose and 100&mu;L of binding reaction. Samples were incubated for 30 minutes, centrifugated, supernatant discarted and resuspended in Tris HCl four times , *Mann Whitney test p-value 0.1 computed using R 3.4.2.
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<p>The results indicates that fluorescence retained in cellulose pellet is higher when orthos is present which indicates that the binding between biotinylated FITC and Streptavidin was effective, proving that the activity of both streptavidin and CBM3 remains intact when fused. This validated the Streptavidine head.</p>
+
  
−
<h4>Validation using paramagnetic beads</h4>
 
−
<p> The functionality of Cerberus was further characterized using paramagnetic beads. To bind paramagnetic beads to Cerberus, we performed a click reaction using 3.2 µM of Cerberus protein and 32 µM DBCO-conjugated paramagnetic beads. In control experiment, 32 µM of paramagnetic beads were used. These samples were then incubated with cellulose, and after several washes with resuspension buffer, the magnetic capacity of cellulose using a magnet was observed and filmed (See video below). The cellulose incubated with the Cerberus protein conjugated to paramagnetic beads responded quickly and was totally collected by the magnet in contrast to the control experiment. This definitely highlights the potential of Cerberus for many applications</p>
 
−
<div class="center">
 
−
        <div class="thumb tnone">
 
−
            <div class="thumbinner" style="width:80%;">
 
  
−
<video controls preload="auto" muted="true" style="width : 100%; heigth = auto;" src="https://static.igem.org/mediawiki/2018/1/14/T--Toulouse-INSA-UPS--Collaborations--angeline--ferocell.MOV" alt="Magnetic cellulose">
+
<div align="center">
−
       
+
        <figure class="normal mx-auto">   
−
</video>
+
            <img class="d-block"
−
<div class="magnify">
+
            style="width:60%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/experiments/cloning/pet21-sfgfp-italique.png">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 2: Construction of the plasmid pET21_sfgfp.</b> (A) Agarose gel electrophoresis  of the PCR products generated from the gBlock and pET21 plasmid. 0.8% agarose and EtBr staining were used. (B) Positive clones were identified from the colony PCR screening. T+ and T- refer to positive control (gBlock amplification) and negative control (without DNA matrix), respectively. (C) Double and single-enzymatic digestion of the pET21_sfgfp derived from clone 8 by EcoRV and XhoI (Simulated (left) and experimental (right) patterns).</i></span></figcaption>
 +
        </figure>
 
</div>
 
</div>
−
<br/>
+
<p>Cloning was successful and two plasmids from positive clones (8) was sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation. </P>
−
<b>Figure 7: </b> <b>Video of Cellulose functionnalised with magnetic beads using Cerberus  </b>   
+
 
−
Left : Negative control using Paramagnetic beads alone, Right: Cerberus-Paramagnetic beads
+
<h2>Characterisation</h2>
 +
<h3>Cell-free production of sfGFP</h3>
 +
 
 +
<p>We used the PCR products of <i>tymp, sfgfp</i>, and <i>anti-HER2 nanobody (anti-HER2-nb)</i> as templates for expression with the PURE<I>frex</I> 2.0 kit (See the protocol <a href="https://2023.igem.wiki/toulouse-insa-ups/protocols" target="blank">here</a>). Additionally, we supplemented the reaction with GreenLys reagent for the co-translational incorporation of fluorescent lysine residues, which facilitated the detection of synthesized proteins by SDS-PAGE.</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:60%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/registry/gfp-part/gfp-fig-3.png">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 3: SDS-PAGE analysis of the gene expression products (Mini-PROTEAN TGX Stain-free Gels).</b> The overlay of the GreenLys and stain-free images are shown. Lanes from left to right: negative control without DNA, positive control with <i>dhfr </i>control plasmid, <i>TYMP</i> with an expected size of 52 kDa, <i>sfGFP</i> with an expected size of 26 kDa, <i>anti-HER2-nb</i> with an expected size of 17 kDa, protein ladder.</i></span></figcaption>
 +
        </figure>
 
</div>
 
</div>
 +
<p>The presence of the sfGFP protein at the expected molecular weight was visible in lane 4 (Figure 3). This result confirms the successful production of GFP protein in PURE system under non-repressed conditions.</p>
 +
 +
<h3>Inhibition of transcription of the <i> sfgfp</i> gene by the DhdR repressor</h3>
 +
<p>The aim of the experiments was to establish that the binding of the repressor DhdR to its operator site, <i>dhdO</i>, effectively inhibits transcription of a gene of interest regulated by <i>dhdO</i>. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system.</p>
 +
 +
<p>Inhibition was tested on the <i>sfgfp</i> reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. The biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.</p>
 +
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/dhdr-results-2.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 5: Effect of different concentrations of DhdR on the expression of a fluorescent reporter gene.</b> Experiments 1 and 2 were performed with the same batch of PCR product from clone 8, while a new batch of PCR product from the same clone was used in experiment 3. PUREfrex2.0 was used in all conditions. The intensity value of sfGFP without DhdR was used for normalization. Excitation and emission wavelengths were 488 nm and 510 nm, respectively.
 +
</i></span></figcaption>                                               
 +
</figure>
 
</div>
 
</div>
 +
 +
<p>As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 5). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a <i>dhdO</i> operator sequence  was 1.5 µM, validating the predictions of the biochemical network model.</p>
 +
 +
<p>Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 6). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.</p>
 +
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/dhdr-results-4.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 6: Effect of different concentrations of 2-HG on DhdR repression.</b> PUREfrex2.1 was used. The intensity value of sfGFP without DhdR and with 10 µM 2-HG was used for normalization. Each concentration was corrected taking into account the inactivation effect of 2-HG on PURE system.
 +
</i></span></figcaption>                                               
 +
</figure>
 
</div>
 
</div>
−
</div>
+
 
−
<h2>Conclusion and Perspectives</h2>
+
<h3> In-liposome expression of the <i>sfgfp</i> gene</h3>
−
<p>These results show that Cerberus has the ability to interact simultaneously with cellulose and molecules with DBCO group or biotinylated compounds. This allows multiple possibilities to functionalize cellulose through its linker containing unnatural amino acid (AzF) and/or the linker presenting the engineered monomeric Streptavidin (mSA2). </p>
+
<ul>
−
<p>Fixation of various compounds that can be chemically functionalized can now be achieved envisioning endless possibilities to functionalize cellulose. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details</p>
+
    <li><b> DhdR repression in liposomes</b></li>
 +
<p>Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the <i>sfgfp</i> gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.</p>
 +
<p>Figure 7a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 7b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (Fig. 7c).</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/microscope-1.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figures 7:</b> a) Liposomes were localized with a fluorescent membrane dye. b) Zoom-in image of the liposome area depicted with a red arrow in a. A yellow line crossing the liposome has been appended. c) Fluorescence intensity profile along the line appended in b. The two peaks correspond to the two regions of membrane crossing.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div> 
 +
 
 +
<p>Figure 8a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 8b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 8c. Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes. </p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/microscope-2.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figures 8: Fluorescence microscopy image of  liposomes in the GFP channel.</b> Expressed sfGFP signal was localized in the liposome lumen. a) Large field-of-view. b) Blow-up of the liposome depicted with the red arrow in a. c) Intensity profile along the yellow line appended in b.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div> 
 +
 
 +
    <li><b> Liposomes are capable of expressing GFP in the presence of living cancer cells</b></li>
 +
 
 +
<p>Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the <i>sfgfp</i> gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated in a thermocycler for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for <i>in situ</i> gene expression (sample 2). The latter protocol more closely mimics the <i>in vivo</i> conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.
 +
 
 +
<p>In sample 1, in the field of view displayed in Figures 9, two liposomes were localized using the fluorescent membrane dye (Fig. 9b) but only one exhibits sfGFP signal (Fig. 9c).</p>
 +
 
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/best-measurement/figure4bis.png">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figures 9: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 1).</b> a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of liposomes localized with a fluorescent membrane dye. c) Imaging of liposomes in the GFP channel.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div> 
 +
 
 +
<p>Similar results were obtained with sample 2, as shown in Figures 10.</p>
 +
 
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/registry/part-dhdr-fig-9.png">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figures 10: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 2).</b>a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of a liposome localized with a fluorescent membrane dye. c) Imaging of the same liposome in the GFP channel.
 +
</i></span></figcaption>                                               
 +
</figure>
 +
</div> 
 +
 
 +
<p>No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.</p>
 +
 
 +
</ul>
 +
 
 +
 
 +
<h2>Conclusion </h2>
 +
<p>These experiments provide evidence that this part can be used as a reporter gene to test the 2-HG biosensor. We have also established that this part can be used as a reporter in bulk assays and within liposomes in a tumoral environment containing physiological levels of 2-HG.</p>
 +
 
 
<h2>References</h2>
 
<h2>References</h2>
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
     <li><sup>[1]</sup>Xiao, D., Zhang, W., Guo, W., Liu, Y., Hu, C., Guo, S., Kang, Z., Xu, X., Ma, C., Gao, C., & Xu, P. 2021. A D-2-hydroxyglutarate biosensor based on  specific transcriptional regulator DhdR. Nature Communications 12, 7108. </li>
−
    <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
     <li><sup>[2]</sup>Jezek, P. 2020. 2-Hydroxyglutarate in Cancer Cells. Antioxid Redox Signal, 33(13),903-926.</li>
−
     <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
 
</i>
 
</i>
 
</ol>
 
</ol>
 
</html>
 
</html>
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
−
 
−
<!-- -->
 
−
 
−
 
−
 
−
<!-- Uncomment this to enable Functional Parameter display
 
−
===Functional Parameters===
 
−
<partinfo>BBa_K2668010 parameters</partinfo>
 
−
<!-- -->
 

Latest revision as of 16:51, 10 October 2023


dhdO_sfgfp

sfGFP gene under control of a T7 promoter with an operator site known as dhdO for expression in PURE system.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Introduction

Figure 0: dhdO_sfgfp part

The CALIPSO part BBa_K4768001 is composed of a superfolder gfp gene under the control of DhdR operator site, dhdO. Additionally, the presence of a T7 promoter and terminator allows its expression in PURE system.

This part can be used as a reporter gene to test a biosensor system that relies on the affinity between 2-Hydroxyglutarate (2-HG), an oncometabolite, and DhdR protein. Repression of the sfgfp gene by DhdRis released in the presence of 2-HG. This part is used in our project to validate our biosensor system, which includes the oncometabolite 2-HG, the DhdR protein as a gene repressor, and the dhdO sequence as an operator site.

DhdR is a transcriptional repression factor isolated from the bacteria Achromobacter denitrificans. It is described in the part BBa_K4768000.

Figure 1: Operating principle of our biosensor. In the presence of 2-HG, repression is removed and the gene is expressed leading to the production of the superfolder gfp.

Construction

The sfgfp gene was inserted downstream a T7 promoter with an operator site dhdO, described above. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.

We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):

  • T7term-F: AGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCC
  • T7term-R: GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG

Figure 2: Construction of the plasmid pET21_sfgfp. (A) Agarose gel electrophoresis of the PCR products generated from the gBlock and pET21 plasmid. 0.8% agarose and EtBr staining were used. (B) Positive clones were identified from the colony PCR screening. T+ and T- refer to positive control (gBlock amplification) and negative control (without DNA matrix), respectively. (C) Double and single-enzymatic digestion of the pET21_sfgfp derived from clone 8 by EcoRV and XhoI (Simulated (left) and experimental (right) patterns).

Cloning was successful and two plasmids from positive clones (8) was sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation.

Characterisation

Cell-free production of sfGFP

We used the PCR products of tymp, sfgfp, and anti-HER2 nanobody (anti-HER2-nb) as templates for expression with the PUREfrex 2.0 kit (See the protocol here). Additionally, we supplemented the reaction with GreenLys reagent for the co-translational incorporation of fluorescent lysine residues, which facilitated the detection of synthesized proteins by SDS-PAGE.

Figure 3: SDS-PAGE analysis of the gene expression products (Mini-PROTEAN TGX Stain-free Gels). The overlay of the GreenLys and stain-free images are shown. Lanes from left to right: negative control without DNA, positive control with dhfr control plasmid, TYMP with an expected size of 52 kDa, sfGFP with an expected size of 26 kDa, anti-HER2-nb with an expected size of 17 kDa, protein ladder.

The presence of the sfGFP protein at the expected molecular weight was visible in lane 4 (Figure 3). This result confirms the successful production of GFP protein in PURE system under non-repressed conditions.

Inhibition of transcription of the sfgfp gene by the DhdR repressor

The aim of the experiments was to establish that the binding of the repressor DhdR to its operator site, dhdO, effectively inhibits transcription of a gene of interest regulated by dhdO. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system.

Inhibition was tested on the sfgfp reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. The biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.

Figure 5: Effect of different concentrations of DhdR on the expression of a fluorescent reporter gene. Experiments 1 and 2 were performed with the same batch of PCR product from clone 8, while a new batch of PCR product from the same clone was used in experiment 3. PUREfrex2.0 was used in all conditions. The intensity value of sfGFP without DhdR was used for normalization. Excitation and emission wavelengths were 488 nm and 510 nm, respectively.

As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 5). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a dhdO operator sequence was 1.5 µM, validating the predictions of the biochemical network model.

Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 6). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.

Figure 6: Effect of different concentrations of 2-HG on DhdR repression. PUREfrex2.1 was used. The intensity value of sfGFP without DhdR and with 10 µM 2-HG was used for normalization. Each concentration was corrected taking into account the inactivation effect of 2-HG on PURE system.

In-liposome expression of the sfgfp gene

  • DhdR repression in liposomes

    • Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.

    Figure 7a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 7b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (Fig. 7c).

    Figures 7: a) Liposomes were localized with a fluorescent membrane dye. b) Zoom-in image of the liposome area depicted with a red arrow in a. A yellow line crossing the liposome has been appended. c) Fluorescence intensity profile along the line appended in b. The two peaks correspond to the two regions of membrane crossing.

    Figure 8a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 8b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 8c. Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes.

    Figures 8: Fluorescence microscopy image of liposomes in the GFP channel. Expressed sfGFP signal was localized in the liposome lumen. a) Large field-of-view. b) Blow-up of the liposome depicted with the red arrow in a. c) Intensity profile along the yellow line appended in b.
  • Liposomes are capable of expressing GFP in the presence of living cancer cells

    • Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated in a thermocycler for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for in situ gene expression (sample 2). The latter protocol more closely mimics the in vivo conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.

    In sample 1, in the field of view displayed in Figures 9, two liposomes were localized using the fluorescent membrane dye (Fig. 9b) but only one exhibits sfGFP signal (Fig. 9c).

    Figures 9: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 1). a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of liposomes localized with a fluorescent membrane dye. c) Imaging of liposomes in the GFP channel.

    Similar results were obtained with sample 2, as shown in Figures 10.

    Figures 10: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 2).a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of a liposome localized with a fluorescent membrane dye. c) Imaging of the same liposome in the GFP channel.

    No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.

Conclusion

These experiments provide evidence that this part can be used as a reporter gene to test the 2-HG biosensor. We have also established that this part can be used as a reporter in bulk assays and within liposomes in a tumoral environment containing physiological levels of 2-HG.

References

  1. [1]Xiao, D., Zhang, W., Guo, W., Liu, Y., Hu, C., Guo, S., Kang, Z., Xu, X., Ma, C., Gao, C., & Xu, P. 2021. A D-2-hydroxyglutarate biosensor based on specific transcriptional regulator DhdR. Nature Communications 12, 7108.
  2. [2]Jezek, P. 2020. 2-Hydroxyglutarate in Cancer Cells. Antioxid Redox Signal, 33(13),903-926.
    3.