Difference between revisions of "Part:BBa K200006:Design"

(→‎Design Notes)
(→‎Design Notes)
 
(7 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K200006 short</partinfo>
 
<partinfo>BBa_K200006 short</partinfo>
 +
 +
Sequence codes for trehalose phosphatase enzyme. This enzyme is the second of two required for the conversion of glucose to trehalose. <br>
 +
This enzyme catalyses the following reaction: <br>
 +
alpha,alpha-trehalose 6-phosphate + H2O -> alpha,alpha-trehalose + phosphate  <br>
 +
<br>
 +
 +
Trehalose is a disaccharide formed from two glucose molecules. Throughout nature, trehalose is associated with resistance to dessication and cold shock <cite>otsb1</cite>, and is naturally produced in Escherichia Coli. We hope that by upregulating the trehalose production pathways in E.coli we can increase trehalose concentrations within our cell, thereby conferring some resistance to protein degredation in our system. This would allow easy transport and storage of the final product.<br><br>
 +
 +
  
 
<partinfo>BBa_K200006 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K200006 SequenceAndFeatures</partinfo>
Line 6: Line 15:
  
 
===Design Notes===
 
===Design Notes===
−
PCR from Escherichia Coli BL21(DE3)  
+
PCR from Escherichia Coli using BL21(DE3) as the genomic DNA template and the Pfu Ultra II enzyme. Primers were designed to include overhangs coding for XbaI and SpeI recognition sites in order to allow the gene to be BioBricked according to the BioBrick Standard. The primers are as follows:
−
 
+
<br>
−
Primers Used:<br>
+
<br>
−
Forward: <br>
+
Forward PCR primer containing XbaI overhang (bold) for BioBricking: <br>
 
<b>GCTCTAG</b>ATGACAGAACCGTTAACCG <br>
 
<b>GCTCTAG</b>ATGACAGAACCGTTAACCG <br>
 
Recomended Temperatures for PCR : 54.5C(without overhang) and 64.8C(with overhang)
 
Recomended Temperatures for PCR : 54.5C(without overhang) and 64.8C(with overhang)
 
<br><br>
 
<br><br>
−
Reverse:<br>  
+
Reverse PCR primer containing SpeI overhang (bold) for BioBricking: <br>  
 
<b>GGACTAGTA</b>TTAGATACTACGACTAAACGAC<br>
 
<b>GGACTAGTA</b>TTAGATACTACGACTAAACGAC<br>
−
Recomended Temperatures for PCR : 54.7C(without overhang) and 64.2C(with overhang)<br>
+
Recomended Temperatures for PCR : 54.7C(without overhang) and 64.2C(with overhang)<br><br>
 
<i>Biobrick Overhang shown in Bold</i>
 
<i>Biobrick Overhang shown in Bold</i>
−
 
−
===Source===
 
−
 
−
Coding sequence isolated from e-coli
 
  
 
===References===
 
===References===
 +
<biblio>#otsb1 pmid=12105274 </biblio>

Latest revision as of 21:26, 19 October 2009

OtsB: Part 2 of 2 coding for trehalose producing enzymes

Sequence codes for trehalose phosphatase enzyme. This enzyme is the second of two required for the conversion of glucose to trehalose.
This enzyme catalyses the following reaction:
alpha,alpha-trehalose 6-phosphate + H2O -> alpha,alpha-trehalose + phosphate

Trehalose is a disaccharide formed from two glucose molecules. Throughout nature, trehalose is associated with resistance to dessication and cold shock otsb1, and is naturally produced in Escherichia Coli. We hope that by upregulating the trehalose production pathways in E.coli we can increase trehalose concentrations within our cell, thereby conferring some resistance to protein degredation in our system. This would allow easy transport and storage of the final product.



Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 455
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

PCR from Escherichia Coli using BL21(DE3) as the genomic DNA template and the Pfu Ultra II enzyme. Primers were designed to include overhangs coding for XbaI and SpeI recognition sites in order to allow the gene to be BioBricked according to the BioBrick Standard. The primers are as follows:

Forward PCR primer containing XbaI overhang (bold) for BioBricking:
GCTCTAGATGACAGAACCGTTAACCG
Recomended Temperatures for PCR : 54.5C(without overhang) and 64.8C(with overhang)

Reverse PCR primer containing SpeI overhang (bold) for BioBricking:
GGACTAGTATTAGATACTACGACTAAACGAC
Recomended Temperatures for PCR : 54.7C(without overhang) and 64.2C(with overhang)

Biobrick Overhang shown in Bold

References

<biblio>#otsb1 pmid=12105274 </biblio>