<p>The CALIPSO part BBa_K4768005 is composed of the N-terminal subunit of the T7 RNA polymerase (residues 1 to 180) fused to the anti-HER2 antibody Pertuzumab through a soluble linker. This gene is under transcriptional control of an SP6 promoter and T7 terminator.</p>
+
+
<p>This part, coupled to the part BBa_K4768005 containing the N-terminal subunit of the T7 RNA polymerase, has been designed to develop a split T7 RNAP-based biosensor capable of recognizing HER-2, an epidermal growth factor that is overexpressed in cancer cells [1], in solution.</p>
+
+
<p>The HER2-induced T7 RNAP complex was designed from two existing constructs: a split T7 RNAP-based biosensor for the detection of rapamycin[1] and a split luciferase conjugated with antibodies capable of recognizing HER2. We decided to merge the relevant functionalities of these two constructs and created a new biosensor that transduces HER2 binding to gene expression activation. </p>
<figcaption class="normal"><span class="titre-image"><i><b>Figure 2: Recognition of HER2 extracellular domain induces functional assembly of the split T7 RNA polymerase, which enables gene expression of target gene under control of a T7 promoter.</b></i></span></figcaption>
+
</figure>
+
</div>
<h2>Construction</h2>
<h2>Construction</h2>
−
<p>TXXXXXX.</p>
+
<p>The CALIPSO part BBa_K4768006 consists in the C-terminal subunit of the T7 RNA polymerase fused to trastuzumab, an anti-HER2 antibody, on his C-terminal domain through an 8-amino-acid-long linker of glycines and serines. The synthesis of this gBlock was made by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.</p>
+
+
+
<p>We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):
<figcaption class="normal"><span class="titre-image"><i><b>Figure 3</b>One of the Agarose Gel Electrophoresis Results for PCR Screening on Plasmid Extracts from 24 Clones.</i></span></figcaption>
+
</figure>
+
</div>
+
+
<p>24 transformants were screened by colony PCR with primers flanking the insertion site within pET21 ( using primers T7-F and T7-R). Unfortunately, no positive transformant was detected (fig. 3).</p>
−
<h2>Molecular Modeling</h2>
−
<p>TXXXXXX.</p>
−
<h2>Characterisation</h2>
−
<p>TXXXXXX.</p>
−
<h2>Conclusion and Perspectives</h2>
+
<h2>Conclusion</h2>
−
<p>TXXXXXX.</p>
+
<p>Due to unsuccessful cloning of this part, we weren't able to progress further with this component and BBa_K4768005, hindering our ability to test the functionality of this biosensor system. Due to time constraints, we couldn't explore alternative cloning strategies thoroughly. We encourage future iGEM teams to consider different cloning approaches, continue the characterization of the biosensor, and feel free to contact us for additional information.</p>
<h2>References</h2>
<h2>References</h2>
<ol>
<ol>
<i>
<i>
−
<li>article 1 xxxxxxxx</li>
+
<li><a href="https://www.mdpi.com/1424-8247/14/3/221" target="_blank">Jois <I>et al</I>. 2021. Peptidomimetic Ligand-Functionalized HER2 Targeted Liposome as Nano-Carrier Designed for Doxorubicin Delivery in Cancer Therapy. Pharmaceuticals. 14(3). 221</a></li>
−
<li>article 2 xxxxxxx</li>
+
<li><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5823606/" target="blank"> Pu, J., Zinkus-Boltz, J., Dickinson, B. C. 2017. Evolution of a split RNA polymerase as a versatile biosensor platform. Nat Chem Biology 13(4). 432-438.</a></li>
+
<li><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2955838/" target="blank">Stains, C. I., Furman, J. L., Porter, J. R., Rajagopal, S., Li, Y., Wyatt, R. T., Ghosh, I. 2010. A General Approach for Receptor and Antibody-Targeted Detection of Native Proteins utilizing Split-Luciferase Reassembly. ACS Chem Biol 5(10). 943-952</a></li>
</i>
</i>
</ol>
</ol>
</html>
</html>
Revision as of 12:13, 10 October 2023
Split T7 RNA polymerase Cterm conjugated to Trastuzumab with a soluble linker
Part for expression of the split T7 RNA polymerase Cterm conjugated to Trastuzumab with a soluble linker in PURE System
Sequence and Features
Assembly Compatibility:
10
INCOMPATIBLE WITH RFC[10]
Illegal XbaI site found at 40
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
INCOMPATIBLE WITH RFC[23]
Illegal XbaI site found at 40
25
INCOMPATIBLE WITH RFC[25]
Illegal XbaI site found at 40 Illegal NgoMIV site found at 1080 Illegal AgeI site found at 549
1000
INCOMPATIBLE WITH RFC[1000]
Illegal BsaI.rc site found at 21
Introduction
Figure 1: Trastuzumab-SL-T7Cterm structure
The CALIPSO part BBa_K4768005 is composed of the N-terminal subunit of the T7 RNA polymerase (residues 1 to 180) fused to the anti-HER2 antibody Pertuzumab through a soluble linker. This gene is under transcriptional control of an SP6 promoter and T7 terminator.
This part, coupled to the part BBa_K4768005 containing the N-terminal subunit of the T7 RNA polymerase, has been designed to develop a split T7 RNAP-based biosensor capable of recognizing HER-2, an epidermal growth factor that is overexpressed in cancer cells [1], in solution.
The HER2-induced T7 RNAP complex was designed from two existing constructs: a split T7 RNAP-based biosensor for the detection of rapamycin[1] and a split luciferase conjugated with antibodies capable of recognizing HER2. We decided to merge the relevant functionalities of these two constructs and created a new biosensor that transduces HER2 binding to gene expression activation.
Figure 2: Recognition of HER2 extracellular domain induces functional assembly of the split T7 RNA polymerase, which enables gene expression of target gene under control of a T7 promoter.
Construction
The CALIPSO part BBa_K4768006 consists in the C-terminal subunit of the T7 RNA polymerase fused to trastuzumab, an anti-HER2 antibody, on his C-terminal domain through an 8-amino-acid-long linker of glycines and serines. The synthesis of this gBlock was made by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid with Takara In-Fusion kit (In-Fusion® Snap Assembly Master Mix, 638948) and introduced into Stellar competent cells.
We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):
Primer T7-F: agttcctcctttcagatttaggtgacactataggggagac
Primer T7-R: gagatctcgatcccgcaaaaaacccctcaagacccg
Figure 3One of the Agarose Gel Electrophoresis Results for PCR Screening on Plasmid Extracts from 24 Clones.
24 transformants were screened by colony PCR with primers flanking the insertion site within pET21 ( using primers T7-F and T7-R). Unfortunately, no positive transformant was detected (fig. 3).
Conclusion
Due to unsuccessful cloning of this part, we weren't able to progress further with this component and BBa_K4768005, hindering our ability to test the functionality of this biosensor system. Due to time constraints, we couldn't explore alternative cloning strategies thoroughly. We encourage future iGEM teams to consider different cloning approaches, continue the characterization of the biosensor, and feel free to contact us for additional information.
