Difference between revisions of "Part:BBa K4743005:Design"
(→Design Notes) |
(→Design Notes) |
||
Line 9: | Line 9: | ||
1. We choose the NAMPT from Ralstonia solanacearum, because it has the highest activity compare to other organism's NAMPT. | 1. We choose the NAMPT from Ralstonia solanacearum, because it has the highest activity compare to other organism's NAMPT. | ||
− | 2.AAGGTACCGCAGGTGGGATCC is the forward primer of Adapter 1 | + | 2. AAGGTACCGCAGGTGGGATCC is the forward primer of Adapter 1 |
TCACCGGTGCAGGTGGAATTC is the reverse primer of Adapter 2 | TCACCGGTGCAGGTGGAATTC is the reverse primer of Adapter 2 |
Revision as of 05:19, 9 October 2023
NadV+ADH1 terminator with adapter
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1689
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1689
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1689
Illegal BglII site found at 515
Illegal BamHI site found at 16
Illegal BamHI site found at 367
Illegal BamHI site found at 975 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1689
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1689
Illegal AgeI site found at 1702 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
1. We choose the NAMPT from Ralstonia solanacearum, because it has the highest activity compare to other organism's NAMPT.
2. AAGGTACCGCAGGTGGGATCC is the forward primer of Adapter 1
TCACCGGTGCAGGTGGAATTC is the reverse primer of Adapter 2
Also, BamHI is included in adapter 1 and EcoRI is included in Adpater 2. These two site can be used for cloning
Source
Ralstonia solanacearum