Difference between revisions of "Part:BBa K4768000"

Revision as of 18:42, 8 October 2023

DhdR repressor

Part for expression and purification of our transcriptional repressor DhdR for biosensing.

Sequence and Features

       <figure class="normal mx-auto">    
           <img
           class="d-block"
           style="width:60%;"
           src=""> 
       </figure>

Introduction

The CALIPSO part (BBa_K4768000) consists of the transcriptional repression factor, DhdR, which has been isolated from the bacterium Achromobacter denitrificans. The codon sequence has been optimized for expression in E.coli. Additionally, the presence of a T7 promoter and terminator enables its inducible expression by IPTG in E.coli BL21 (DE3). Finally, a Histidine tag is included in the sequence to facilitate the purification of DhdR.

This transcriptional repressor was employed in our biosensing system, which was inspired by the work of Ping Xu et al. [1] and the work conducted by iGEM Duke 2021. Our objective was to use the affinity between 2-Hydroxyglutarate, an oncometabolite, and DhdR to trigger the production of our drug-activating enzyme when liposomes are situated in a tumoral environment. To achieve this, we positioned our gene of interest under the control of the operator site of DhdR, referred to as dhdO.

Construction

The CALIPSO part BBa_K4768000 comprises the transcriptional repression factor DhdR fused with a histidine tag at its N-terminus. The synthesis of this gBlock was performed and provided by IDT.

The gBlock was then cloned into the pET_21a(+) plasmid and transformed into Stellar competent cells.

• DhdR-pET21-F: AGCAGCCGGATCTCATCATGACGTCTGACGCGC
• DhdR-pET21-R: GAAGGAGATATACATATGGGCCATCATCATCATCATC

Figure 2 shows the enzymatic restriction pattern of the resulting clones. Clone 4 was digested using EcoRV and NdeI. Two bands were expected at 1.3 kb and 4.8 kb, as experimentally measured (lane 5).

Clone 4 was sequence verified.

Characterization

1) Production and purification of DhdR

The pET21a(+) vector including the dhdR insert was transformed into E.coli strain BL21 (DE3). This strain was provided by Cédric Montanier (researcher at TBI). When DO reaches 0.5-0.6, expression of the recombinant protein was induced overnight at 16°C using IPTG. The His-tagged protein was then purified on TALON® Metal Affinity Resin. Pure fractions were assessed by SDS-PAGE.Results are shown in Figure 3.

The expected size for DhdR is 28.27 kDa. Clear bands were observed for the four elution fractions E1₅₀, E1₁₀₀, E1₂₅₀ and E1 500, but not in the negative control sample, as expected. These data show that DhdR was efficiently purified and can be used for subsequent assays.

The E1₂₅₀ fraction was dialysed leading to a concentration of 14.4 µM (> 95% pure protein). Fractions E1₁₀₀ and E1₅₀₀ were pooled and dialysed, resulting in a concentration of 7.63 µM (> 95% pure protein).

2) Functionality tests in PURE system

The aim of our experiments was to establish that the binding of the repressor DhdR to its operator site, dhdO, effectively inhibits transcription of a gene of interest regulated by dhdO. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system.

Inhibition was tested on the sfgfp reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. Our biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.

As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 4). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a dhdO operator sequence was 1.5 µM, validating the predictions of the biochemical network model.

Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 5). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.

3) In-liposome expression of the sfgfp gene

• DhdR repression in liposomes

Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.

Figure 6a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 6b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (Fig. 6c).



Figure 7a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 7b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 7c. Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes.



• Liposomes are capable of expressing GFP in the presence of living cancer cells

Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated in a thermocycler for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for in situ gene expression (sample 2). The latter protocol more closely mimics the in vivo conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.

In sample 1, in the field of view displayed in Figure 8, two liposomes were localized using the fluorescent membrane dye (Fig. 8b) but only one exhibits sfGFP signal (Fig. 8c).



Similar results were obtained with sample 2, as shown in Figure 9.



No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.

Molecular Modeling

1) Model-driven feasibility assessment of the 2-HG biosensor

The impact of DhdR on cell-free expression was modeled through a set of differential equations inspired from iGEM Teams Duke 2021 and Delft 2021, and implemented on COPAS v(4.38)I.

The responsiveness of our anticancer liposome to a tumoral environment is a key design feature for limiting toxic side-effects. We thus used the model to evaluate whether 5-FU was produced at higher concentration in the presence of 2-HG (synthesized by cancer cells) compared to its absence. In absence of 2-HG, we expect the expression of TYPH to be repressed and, therefore, only a small amount of 5-FU would be produced. Consistently, simulations shown in Fig. 3 predicted that 1.5 μM of DhdR repressed gene expression, resulting in a ~2-fold lower concentration of 5-FU outside the liposome. Adding 100 μM of 2-HG, corresponding to typical concentrations in surrounding tumors [2], derepressed the system and boosted 5-FU production. The model therefore met the behavior expected for our liposomes and confirmed that our targeted drug production strategy could help tackle adverse effects of current chemotherapies.

2) Guiding experiments and validating the model

We used the model to determine the optimal concentration of DhdR to be encapsulated in our liposome. To that aim, we built a reduced model containing only the biosensing and gene expression modules, along with a gene encoding the sfGFP protein that was used in our experiments as a reporter. To verify model predictions, we carried out the same experiments as done in silico using the same concentration range of DhdR and 2-HG.

A gradual decrease in the fluorescence intensity, i.e., in the expression of sfgfp, was experimentally verified when increasing the concentration of DhdR. Importantly, the measurements are consistent with the model predictions qualitatively, confirming the parameter values and structure of the model.

Experimental results confirm that increasing 2-HG concentration progressively lifts the repression caused by DhdR. However, the model poorly predicted the gradual increase of sfGFP levels measured experimentally, as it was more sensitive to lower concentrations of 2HG.

We thus decided to use our measurements to refine the model. We estimated the values of different parameters of the biosensing module (k_D2, k_-D2, k_D0, k_-D0, k_DH and k_-DH) by fitting our experimental data. In comparison to the predictions of the ab initio model constructed from the literature, the simulations with the refined parameter values were in quantitative agreement with our measurements. Importantly, the refined model with the calibrated biosensor module was also able to accurately simulate protein expression levels in the presence of 2-HG, corroborating its improved predictive power (Fig. 11).

Conclusion and Perspectives

These experiments provide evidence that our 2-HG biosensor that relies on the part BBa_K4768000 is functional in bulk reactions at concentrations of oncometabolite that are physiologically relevant. Our biochemical network model was used to predict DhdR concentrations, and then optimized according to experimental results. Moreover,we established a protocol for encapsulating DhdR, the expression product of the part BBa_K4768000, inside liposomes. Although DhdR-based repression was not clearly demonstrated in vesicles, we gave recommendations and provided image analysis tools for future investigations.

References

1. ^[1]Xiao, D., Zhang, W., Guo, W., Liu, Y., Hu, C., Guo, S., Kang, Z., Xu, X., Ma, C., Gao, C., & Xu, P. 2021. A D-2-hydroxyglutarate biosensor based on specific transcriptional regulator DhdR. Nature Communications 12, 7108.
2. ^[2]Jezek, P. 2020. 2-Hydroxyglutarate in Cancer Cells. Antioxid Redox Signal, 33(13),903-926.