|
|
| Line 9: |
Line 9: |
| | ===Usage and Biology=== | | ===Usage and Biology=== |
| | | | |
| − | Aiming to develop this bule-light-activated suicide system, where our engineering E. coli will be killed during the absence of blue light, namely in dark or at night, we equipped our engineering bacteria with a special part to produce EL222, a llight-regulated DNA-binding protein. This protein can harness blue light to drive the reorientation of its Light-Oxygen-Voltage (LOV) sensory and Helix-Turn-Helix (HTH) effector domains, resulting in its self-dimerization and thus biding to the EL222 binding region located in between −35 (TTGACA) and −10 (TATAAT) region of the luxI promoter.
| + | This system (QS suicide system) is a system that will self-start when our engineering bacteria are lost to the nature.In this case, as we add this QS suicide system in to engineering bacteria, it can take precaution against the danger of the engineering bacteria’s leakage. |
| − | T7 promoter combining with the Ribosome Binding Site (RBS) starts the transcription and translation processes of the DNA sequence coding for EL222 protein. The protein is stored in KEGG database as ELI_04755, which the gene sequence being expressed is: ATGTTGGATATGGGACAAGATCGGCCGATCGATGGAAGTGGGGCACCCGGGGCAGACGACACACGCGTTGAGGTGCAACCGCCGGCGCAGTGGGTCCTCGACCTGATCGAGGCCAGCCCGATCGCATCGGTCGTGTCCGATCCGCGTCTCGCCGACAATCCGCTGATCGCCATCAACCAGGCCTTCACCGACCTGACCGGCTATTCCGAAGAAGAATGCGTCGGCCGCAATTGCCGATTCCTGGCAGGTTCCGGCACCGAGCCGTGGCTGACCGACAAGATCCGCCAAGGCGTGCGCGAGCACAAGCCGGTGCTGGTCGAGATCCTGAACTACAAGAAGGACGGCACGCCGTTCCGCAATGCCGTGCTCGTTGCACCGATCTACGATGACGACGACGAGCTTCTCTATTTCCTCGGCAGCCAGGTCGAAGTCGACGACGACCAGCCCAACATGGGCATGGCGCGCCGCGAACGCGCCGCGGAAATGCTCAAGACGCTGTCGCCGCGCCAGCTCGAGGTTACGACGCTGGTGGCATCGGGCTTGCGCAACAAGGAAGTGGCGGCCCGGCTCGGCCTGTCGGAGAAAACCGTCAAGATGCACCGCGGGCTGGTGATGGAAAAGCTCAACCTGAAGACCAGCGCCGATCTGGTGCGCATTGCCGTCGAAGCCGGAATCTGA (678 nt).
| + | |
| − | With the assistance of the T7 terminator, EL222 protein can thus be successfully synthesized using the parts provided above.
| + | |
| − | As EL222 is able to homodimerize under blue light, during normal laboratory or under daytime conditions, it would induce conformational change in its LOV and HTH domains to form dimers which would later bind to the EL222 binding regions. This binding causes the release of the RNA polymerase (RNAP) sitting also in between the -35 to -10 luxI promoter region. Without RNAP, the CAS9 protein and its sgRNA cannot be expressed and used in gene editing. Consequently, the suicide system cannot complete and the ATP synthase as well as DNA polymerase of the E. coli cell continues to function, meaning that the bacteria will still survive in the external environment.
| + | |
| − | However, as nighttime approaches and blue light gradually disappears, the homodimerization of EL222 protein could not be activated and thus is unable to compete with RNAP and bind to its binding region within the luxI promoter region. The RNAP will thus take its place and start the transcription process of CAS9 downstream, which is also assisted by the H1 promoter. Cas9 is a sizable protein weighing 160 kilodaltons, serving a crucial role in the immune defence of specific bacteria against DNA viruses and plasmids. Nowadays, it is heavily employed in genetic engineering. In our design of the suicide system, the Cas9 employed contains a unique sgRNA, a specific RNA sequence identifying the target DNA region for editing.
| + | |
| − | Two types of CAS9 proteins and their corresponding sgRNA sequences are utilized in this part of design. The CAS9-A and sgRNA-A together collaborate to cut the ATP synthase within E. coli, rendering it nonfunctional. To pinpoint this particular sgRNA, we first identified the specific ATP synthase subunit that is crucial for the function of ATP synthase to produce ATP from ADP, labelled as P68699 on UniProt and named ATP synthase subunit C. Upon obtaining its full sequence, we utilized the sgRNA design tool at the website CRISPR direct to create the precise sgRNA sequence, GAATATGGATCTGCTGTACATTGG. The other sgRNA-R in CAS9-R is designed by similar methods, except for the fact that it is used to target DNA-directed RNA polymerase subunit beta which serves as the building block of RNA polymerase in E. coli. Without the enzyme catalysing the transcription of DNA into RNA, E. coli would not be able to produce the proteins needed for its survival and would thus die. The specific sgRNA-R sequence is CGAGAAAAAACGTATTCGTAAGG. The two types of CAS9 protein targeting the parts involved in essential bacterial metabolism serve as a strong double-layered protection to the environment, as the engineering E. coli will be deactivated as soon as CAS9 is activated.
| + | |
| − | In this way, once blue light is undetectable by EL222, the formation of EL222 dimers is terminated and the RNAP is allowed to bind back to the -35 to -10 region of the luxI promoter. This thereby activates the expression of the two types of CAS9 (CAS9-A and CAS9-R) and their sgRNA sequence (sgRNA-A and sgRNA-R). The gene editing processes takes place after that, disrupting two of the most crucial parts of the bacterial cell’s metabolic pathways, energy and protein production, which eventually cause the death of bacteria.
| + | |
| − | By integrating this blue light suicide system into our engineering bacteria, precautions against potential leakage risks are established. Our engineering E. coli will not be able to survive in the external environment for more than a day, as when the night falls, it is forced to “commit suicide”. The detailed designs and procedures are illustrated in the figure below.
| + | |
| − | | + | |
| | | | |
| | <!-- Add more about the biology of this part here | | <!-- Add more about the biology of this part here |
CRISPR/Cas9 is a gene editing technology used to inhibit the expression from the targeted sequence inducing DNA to activate its self-repair process. sgRNA will be attached to the CRISPR/Cas9 to target the desired area.
This system (QS suicide system) is a system that will self-start when our engineering bacteria are lost to the nature.In this case, as we add this QS suicide system in to engineering bacteria, it can take precaution against the danger of the engineering bacteria’s leakage.
