Difference between revisions of "Part:BBa K4317099"

 
(6 intermediate revisions by the same user not shown)
Line 5: Line 5:
 
This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099)
 
This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099)
  
https://static.igem.org/mediawiki/parts/thumb/6/6a/Secretion_signal_library.png/644px-Secretion_signal_library.png
+
=BBa_K4317099=
 +
 
 +
https://static.igem.org/mediawiki/parts/thumb/a/ad/SP_libray.png/800px-SP_libray.png
 +
 
 +
=AIO t-vector-BBa_K4317099=
 +
 
 +
https://static.igem.org/mediawiki/parts/thumb/d/df/Secretion_signal_library-tvector.png/644px-Secretion_signal_library-tvector.png
 +
 
 +
=PCR product=
 +
 
 +
https://static.igem.org/mediawiki/parts/thumb/6/6a/Secretion_signal_library.png/800px-Secretion_signal_library.png
  
 
===Usage and Biology===
 
===Usage and Biology===
 
We did not digest the plasmid DNA directly with NdeI or NcoI, but cut the library part after amplification  
 
We did not digest the plasmid DNA directly with NdeI or NcoI, but cut the library part after amplification  
 
using the primers (AIO F- GGATAACCGTATTACCGCCT TTGAG, AIO R- CACAAACAGACGATAACGGCTCTC) shown in Fig. 1 (Fig. 2, 3). Secretion signal fragments were ligated with the DNA fragments coding for each enzyme with Bacillus and E. coli expression vectors and transformed (Fig. 4).
 
using the primers (AIO F- GGATAACCGTATTACCGCCT TTGAG, AIO R- CACAAACAGACGATAACGGCTCTC) shown in Fig. 1 (Fig. 2, 3). Secretion signal fragments were ligated with the DNA fragments coding for each enzyme with Bacillus and E. coli expression vectors and transformed (Fig. 4).
 
 
Figure 1. Plasmid map of signal peptide library
 
  
 
https://static.igem.org/mediawiki/parts/thumb/2/27/Library_PCR.png/529px-Library_PCR.png
 
https://static.igem.org/mediawiki/parts/thumb/2/27/Library_PCR.png/529px-Library_PCR.png
Line 22: Line 29:
 
Figure 3. secretion signal fragments digested by NdeI, NcoI
 
Figure 3. secretion signal fragments digested by NdeI, NcoI
  
 +
https://static.igem.org/mediawiki/parts/thumb/9/95/Page.png/800px-Page.png
 +
 +
Figure 4. SDS-PAGE and western blot of cellulose-degrading enzymes secreted from B. subtilis and E. coli
 +
 +
The combination of 16 secretion signals and enzymes found previously was subcloned using the IPTG inducible system. These plasmids were transformed into Bacillus 1A976 and E. coli BL21 and filtered with a 0.2um CA syringe filter after induction with IPTG. Each sample was separated by size through SDS-PAGE. The resolved protein was transferred to a 0.45um PVDF membrane and then immunoblotted with an anti-his tag antibody. Finally, the blotted membrane was stained with amido black
 
==Sequence and Features==
 
==Sequence and Features==
 
<partinfo>BBa_K4317099 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K4317099 SequenceAndFeatures</partinfo>

Latest revision as of 13:53, 12 October 2022


Secretion signal library

This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099)

BBa_K4317099

800px-SP_libray.png

AIO t-vector-BBa_K4317099

644px-Secretion_signal_library-tvector.png

PCR product

800px-Secretion_signal_library.png

Usage and Biology

We did not digest the plasmid DNA directly with NdeI or NcoI, but cut the library part after amplification using the primers (AIO F- GGATAACCGTATTACCGCCT TTGAG, AIO R- CACAAACAGACGATAACGGCTCTC) shown in Fig. 1 (Fig. 2, 3). Secretion signal fragments were ligated with the DNA fragments coding for each enzyme with Bacillus and E. coli expression vectors and transformed (Fig. 4).

529px-Library_PCR.png

Figure 2. PCR product containing the signal peptide library

452px-Re.png

Figure 3. secretion signal fragments digested by NdeI, NcoI

800px-Page.png

Figure 4. SDS-PAGE and western blot of cellulose-degrading enzymes secreted from B. subtilis and E. coli

The combination of 16 secretion signals and enzymes found previously was subcloned using the IPTG inducible system. These plasmids were transformed into Bacillus 1A976 and E. coli BL21 and filtered with a 0.2um CA syringe filter after induction with IPTG. Each sample was separated by size through SDS-PAGE. The resolved protein was transferred to a 0.45um PVDF membrane and then immunoblotted with an anti-his tag antibody. Finally, the blotted membrane was stained with amido black

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 820
  • 1000
    COMPATIBLE WITH RFC[1000]