Difference between revisions of "Part:BBa K4317099"

Revision as of 13:29, 12 October 2022

Secretion signal library

This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099)

Usage and Biology

We did not digest the plasmid DNA directly with NdeI or NcoI, but cut the library part after amplification using the primers (AIO F- GGATAACCGTATTACCGCCT TTGAG, AIO R- CACAAACAGACGATAACGGCTCTC) shown in Fig. 1 (Fig. 2, 3). Secretion signal fragments were ligated with the DNA fragments coding for each enzyme with Bacillus and E. coli expression vectors and transformed (Fig. 4).

Figure 1. Plasmid map of signal peptide library

Figure 2. PCR product containing the signal peptide library

Figure 3. secretion signal fragments digested by NdeI, NcoI

Sequence and Features