Difference between revisions of "Part:BBa K4247024:Design"

(→‎References)
 
(5 intermediate revisions by 2 users not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
The enzyme tyrosinase is an oxidase found across taxa, it contains copper and is well known for its tyrosine modifying step that gives melanin. Our project specifically focused on converting the tyrosines of mfp151 (parts BBa_K4247020, BBa_K4247021) into DOPA in E.coli, a post-translational modification that makes mfp sticky. A way to achieve this dopaquinone conversion is by first producing mfp in vitro and then expose it to tyrosinase, but it has the limitations of having to purify the enzymes and of not allowing the dopa modification to occur in all the tyrosines that are not exposed to the enzyme. For this reason, we focused on a co-expression system where E.coli would have mfp151 on a plasmid and tyrosinase with its copper cofactor (orf438) on another. By inducing with IPTG, the tyrosines incorporated in the mfp151 protein have been hydroxylated to DOPA.
+
We produced this part as a component of the composite part BBa_K4247024, the orf438-tyrosinase operon. The products of this operon enables the host to perform PTMs on the tyrosine residues in vivo. To do so, we placed orf438 after a common E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA), followed by TATACAT, a small sequence and then, a 6-His Tag (ATGCGGGGTTCT). After the 6-His Tag, we placed a glycine residue, followed by the original Orf438 coding sequence.
 +
 
 +
Since in the organism S. antibioticus, the orf438 and tyrosinase are placed in an operon, we decided to place a spacer (AAGCACTAATAAT) after the end of the orf438 coding sequence, and then repeat the E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA). After few a small sequence (TTATCTG), the tyrosinase coding sequence begins. The tyrosinase coding sequence is followed by another 6-His Tag. The plasmid construction can be seen in the image below.
 +
 
 +
In our system we placed first the orf438 and then the tyrosinase sequence, to better simulate the results found by Barnan et al., 1985. However, Choi et al., 2012 placed the orf438 after the tyrosinase gene.
 +
 
 +
The protein we were co-expressing, mfp151, was placed in pET24(+) and we therefore, used pRSETa plasmid for expressing the orf438-tyrosinase operon so that the 2 plasmids have different ori and selection markers - Kan for pET24(+) and Amp for pRSETa. The plasmids were induced by using 0.1-0.2 mM IPTG.
  
 
[[File:Oporf438.jpeg|px300|]]
 
[[File:Oporf438.jpeg|px300|]]
  
−
===Source===
 
  
−
NCBI accession: WP_030787646.1 Tyrosinase
+
===Source===
−
NCBI accession: WP_078632176 Orf438 (tyrosinase cofactor)
+
  
 +
The sequence of this composite part is obtained from the following basic parts: <partinfo>BBa_K4247022</partinfo> (Orf438 - Tyrosinase cofactor) and <partinfo>BBa_K4247023</partinfo> (Tyrosinase).
  
 
===References===
 
===References===

Latest revision as of 12:41, 12 October 2022


orf438-tyrosinase operon


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 37
    Illegal NotI site found at 76
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 896
    Illegal AgeI site found at 798
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 1138


Design Notes

We produced this part as a component of the composite part BBa_K4247024, the orf438-tyrosinase operon. The products of this operon enables the host to perform PTMs on the tyrosine residues in vivo. To do so, we placed orf438 after a common E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA), followed by TATACAT, a small sequence and then, a 6-His Tag (ATGCGGGGTTCT). After the 6-His Tag, we placed a glycine residue, followed by the original Orf438 coding sequence.

Since in the organism S. antibioticus, the orf438 and tyrosinase are placed in an operon, we decided to place a spacer (AAGCACTAATAAT) after the end of the orf438 coding sequence, and then repeat the E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA). After few a small sequence (TTATCTG), the tyrosinase coding sequence begins. The tyrosinase coding sequence is followed by another 6-His Tag. The plasmid construction can be seen in the image below.

In our system we placed first the orf438 and then the tyrosinase sequence, to better simulate the results found by Barnan et al., 1985. However, Choi et al., 2012 placed the orf438 after the tyrosinase gene.

The protein we were co-expressing, mfp151, was placed in pET24(+) and we therefore, used pRSETa plasmid for expressing the orf438-tyrosinase operon so that the 2 plasmids have different ori and selection markers - Kan for pET24(+) and Amp for pRSETa. The plasmids were induced by using 0.1-0.2 mM IPTG.

Oporf438.jpeg


Source

The sequence of this composite part is obtained from the following basic parts: BBa_K4247022 (Orf438 - Tyrosinase cofactor) and BBa_K4247023 (Tyrosinase).

References

Choi et al.:In vivo modification of tyrosine residues in recombinant mussel adhesive protein by tyrosinase co-expression in Escherichia coli. Microbial Cell Factories, 2012 11:139.

Bernan V, Filpula D, Herber W, Bibb M, Katz E. The nucleotide sequence of the tyrosinase gene from Streptomyces antibioticus and characterization of the gene product. Gene. 1985;37(1-3):101-10. doi: 10.1016/0378-1119(85)90262-8. PMID: 3932128.