Difference between revisions of "Part:BBa K4317099"
Line 5: | Line 5: | ||
This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099) | This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099) | ||
− | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
+ | We did not digest the plasmid DNA directly with NdeI or NcoI, but cut the library part after amplification | ||
+ | using the primers (AIO F- GGATAACCGTATTACCGCCT TTGAG, AIO R- CACAAACAGACGATAACGGCTCTC) shown in Fig. 1 (Fig. 2, 3). Secretion signal fragments were ligated with the DNA fragments coding for each enzyme with Bacillus and E. coli expression vectors and transformed (Fig. 4). | ||
− | + | https://static.igem.org/mediawiki/parts/thumb/6/6a/Secretion_signal_library.png/644px-Secretion_signal_library.png | |
− | + | ||
+ | Figure 1. Plasmid map of signal peptide library | ||
+ | |||
+ | https://static.igem.org/mediawiki/parts/thumb/2/27/Library_PCR.png/529px-Library_PCR.png | ||
+ | |||
+ | Figure 2. PCR product containing the signal peptide library | ||
+ | |||
+ | https://static.igem.org/mediawiki/parts/thumb/d/dd/Re.png/452px-Re.png | ||
+ | |||
+ | Figure 3. secretion signal fragments digested by NdeI, NcoI | ||
+ | |||
+ | ==Sequence and Features== | ||
<partinfo>BBa_K4317099 SequenceAndFeatures</partinfo> | <partinfo>BBa_K4317099 SequenceAndFeatures</partinfo> | ||
Revision as of 10:56, 12 October 2022
Secretion signal library
This part contains 12 signal peptides that can be used in E. coli and Bacillus subtilis. This part is a composite part composed of the previously registered basic part and the basic part newly registered by our team. Therefore, it is different from the nucleotide sequence we actually used. Therefore, we registered the actual base sequence of the library we used in the basic part. (BBa_K4317099)
Usage and Biology
We did not digest the plasmid DNA directly with NdeI or NcoI, but cut the library part after amplification using the primers (AIO F- GGATAACCGTATTACCGCCT TTGAG, AIO R- CACAAACAGACGATAACGGCTCTC) shown in Fig. 1 (Fig. 2, 3). Secretion signal fragments were ligated with the DNA fragments coding for each enzyme with Bacillus and E. coli expression vectors and transformed (Fig. 4).
Figure 1. Plasmid map of signal peptide library
Figure 2. PCR product containing the signal peptide library
Figure 3. secretion signal fragments digested by NdeI, NcoI
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 820
- 1000COMPATIBLE WITH RFC[1000]