Difference between revisions of "Part:BBa K4417001"

 
 
(5 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K4417001 short</partinfo>
 
<partinfo>BBa_K4417001 short</partinfo>
  
(will add later)
+
<h1>Description</h1>
  
<!-- Add more about the biology of this part here
+
This primer is designed for mutating the ''Bsa''I site 1 in pCT5-''bac'' 2.0. This part is a forward primer with a mutation nucleotide, changing c to g.
===Usage and Biology===
+
 
 +
[[File:Zjy11.png|350px|thumb|center|'''Figure 1:''' pCT5-''bac'' 2.0 with primers for site directed mutagenesis at position 647.]]
 +
 
 +
 
 +
<h1>Usage and Biology</h1>
 +
 
 +
* This part is used in site directed mutagenesis of pCT5c (Part: BBa_K4417000).
 +
* Sequence: tgccctgggt'''t'''tccattgcgc
 +
* Length: 21-mer
 +
* Tm: 61℃
 +
* GC content: 62%
 +
 
 +
[[File:Zjy12.png|700px|thumb|center|'''Figure 2:''' Binding site of SDM1_Fw.]]
 +
 
 +
<h1>Method</h1>
 +
 
 +
This part is used with <partinfo>BBa_K4417000</partinfo> and <partinfo>BBa_K4417002</partinfo>. A detailed protocol is described in <partinfo>BBa_K4417000</partinfo>.
 +
 
 +
<h1>Characterization</h1>
 +
 
 +
This primer will remove one BsaI site, leaving another two BsaI sites. The KLD product was transformed into DH5-α, and the plasmid was checked using a diagnostic digest. From Figure 3, the expected band size can be identified in lanes 2, 7, 11, and 15.
 +
 
 +
[[File:Zjy13.png|700px|thumb|center|'''Figure 3:''' Comparative gel for pCT5c site directed mutagenesis; 1: HyperLadder<sup>TM</sup> 1kb, 2: pCT5-bac 2.0 uncut, 3: SDM1 uncut, 4: SDM1,3 uncut, 5: pCT5c uncut, 6: pCT5c cut with BsaI (3481bp, 2344bp, 2052bp), 7: SDM1 cut with BsaI (4396bp, 3481bp), 8: SDM1,3 cut with BsaI (7877bp), 9: pCT5c cut with BsaI, 10: pCT5-bac 2.0 cut with BamHI/SacI (6851bp, 1026bp), 11: SDM1 cut with BamHI/SacI (6851bp, 1026bp), 12: SDM1,3 cut with BamHI/SacI (6851bp, 1026bp), 13: pCT5c cut with BamHI/SacI (6851bp, 1026bp), 14: pCT5-bac 2.0 cut with BamHI/BsaI (3481bp, 2087bp, 2052bp, 257bp), 15: SDM1 cut with BamHI/BsaI (3481bp, 2309bp, 2087bp), 16: SDM1,3 cut with BamHI/BsaI (5790bp, 2087bp), 17: pCT5c cut with BamHI/BsaI, 18: HyperLadder<sup>TM</sup> 1kb.]]
 +
 
 +
 
 +
<h1>Conclusion</h1>
 +
 
 +
This part has high efficiency and quality in site directed mutagenesis.
  
 
<!-- -->
 
<!-- -->

Latest revision as of 09:38, 12 October 2022


SDM1 Forward Primer for pCT5c Mutation

Description

This primer is designed for mutating the BsaI site 1 in pCT5-bac 2.0. This part is a forward primer with a mutation nucleotide, changing c to g.

Figure 1: pCT5-bac 2.0 with primers for site directed mutagenesis at position 647.


Usage and Biology

  • This part is used in site directed mutagenesis of pCT5c (Part: BBa_K4417000).
  • Sequence: tgccctgggtttccattgcgc
  • Length: 21-mer
  • Tm: 61℃
  • GC content: 62%
Figure 2: Binding site of SDM1_Fw.

Method

This part is used with BBa_K4417000 and BBa_K4417002. A detailed protocol is described in BBa_K4417000.

Characterization

This primer will remove one BsaI site, leaving another two BsaI sites. The KLD product was transformed into DH5-α, and the plasmid was checked using a diagnostic digest. From Figure 3, the expected band size can be identified in lanes 2, 7, 11, and 15.

Figure 3: Comparative gel for pCT5c site directed mutagenesis; 1: HyperLadderTM 1kb, 2: pCT5-bac 2.0 uncut, 3: SDM1 uncut, 4: SDM1,3 uncut, 5: pCT5c uncut, 6: pCT5c cut with BsaI (3481bp, 2344bp, 2052bp), 7: SDM1 cut with BsaI (4396bp, 3481bp), 8: SDM1,3 cut with BsaI (7877bp), 9: pCT5c cut with BsaI, 10: pCT5-bac 2.0 cut with BamHI/SacI (6851bp, 1026bp), 11: SDM1 cut with BamHI/SacI (6851bp, 1026bp), 12: SDM1,3 cut with BamHI/SacI (6851bp, 1026bp), 13: pCT5c cut with BamHI/SacI (6851bp, 1026bp), 14: pCT5-bac 2.0 cut with BamHI/BsaI (3481bp, 2087bp, 2052bp, 257bp), 15: SDM1 cut with BamHI/BsaI (3481bp, 2309bp, 2087bp), 16: SDM1,3 cut with BamHI/BsaI (5790bp, 2087bp), 17: pCT5c cut with BamHI/BsaI, 18: HyperLadderTM 1kb.


Conclusion

This part has high efficiency and quality in site directed mutagenesis.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]