Difference between revisions of "Part:BBa K4441001"
(→‎Usage and Biology)
 
(6 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K4441001 short</partinfo>
 
<partinfo>BBa_K4441001 short</partinfo>
  
−
200 219 20 56.40 -4.76 -4.23 45 TCTGACTGAAAGCTGTATGG
+
Sequence used in wetlab experiments: ACAGAACAATTCCAAATGCATAT is taken from [1]
  
−
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
−
This is the sequence for the outer backward primer. The outer backward primer consists of a B3 region which is complementary to the B3c region of the template sequence [2]. The outer primer B3 hybridizes to B3c region of the target DNA and extends, displacing the BIP linked complementary strand and resulting in the formation of a dumbbell shaped DNA [2]. This B3 primer is part of the primer set that detects the WT BRAF: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG
+
This is the sequence for the Outer Backward Primer. The outer backward primer consists of a B3 region which is complementary to the B3c region of the template sequence [2]. The outer primer B3 hybridizes to B3c region of the target DNA and extends, displacing the BIP linked complementary strand and resulting in the formation of a dumbbell shaped DNA [2]. This B3 primer is part of the primer set that detects the WT BRAF: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGA
 +
GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT
 +
GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG
 +
 
 +
====Dilutions====
 +
 
 +
Storage Primer Concentration: 100 μM
 +
 
 +
10X Concentration (Stock): 16 μM
 +
 
 +
Volume of 10X primer mix: 10 μL
 +
 
 +
1X Concentration (Final): 1.6 μM
 +
 
 +
Volume of storage primer needed: 0.2 μL
 +
 
 +
Mixed with F3, FIP, BIP for a total of 3.6 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington
  
 
==Citations==
 
==Citations==
 
1. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996.
 
1. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996.
 +
 
2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html
 
2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html
 
   
 
   

Latest revision as of 05:34, 12 October 2022


BRAF WT B3

Sequence used in wetlab experiments: ACAGAACAATTCCAAATGCATAT is taken from [1]

Usage and Biology

This is the sequence for the Outer Backward Primer. The outer backward primer consists of a B3 region which is complementary to the B3c region of the template sequence [2]. The outer primer B3 hybridizes to B3c region of the target DNA and extends, displacing the BIP linked complementary strand and resulting in the formation of a dumbbell shaped DNA [2]. This B3 primer is part of the primer set that detects the WT BRAF: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGA GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG

Dilutions

Storage Primer Concentration: 100 μM

10X Concentration (Stock): 16 μM

Volume of 10X primer mix: 10 μL

1X Concentration (Final): 1.6 μM

Volume of storage primer needed: 0.2 μL

Mixed with F3, FIP, BIP for a total of 3.6 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington

Citations

1. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996.

2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]