Difference between revisions of "Part:BBa K4441004"

 
(→‎Alternative Sequence)
 
(5 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K4441004 short</partinfo>
 
<partinfo>BBa_K4441004 short</partinfo>
  
−
54 75 22 60.99 -5.05 -3.87 41 ACTGTGAGGTCTTCATGAAGAA
+
Sequence used in wetlab experiments: GGAAAATGAGATCTACTG is taken from [1]
  
−
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
This is the sequence for the outer forward primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the BRAF V600E:
 +
TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGA
 +
GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT
 +
GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG
  
 +
====Dilutions====
 +
 +
Storage Primer Concentration: 100 μM
 +
 +
10X Concentration (Stock): 16 μM
 +
 +
Volume of 10X primer mix: 10 μL
 +
 +
1X Concentration (Final):1.6 μM
 +
 +
Volume of storage primer needed: 0.2 μL
 +
 +
Mixed with B3, FIP, BIP, LF and LB for a total of 4.4 μL -- Final primer mix
 +
1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington
 +
 +
====Alternative Sequence====
 +
As this set of primer failed to produce a positive result, we used NEB LAMP Primer Design Tool (https://lamp.neb.com/#!/) to generate an alternative set of primers. Unfortunately, due to time and budgetary constraints, these primers have not been ordered and experimented with yet.
 +
 +
Sequence: TACACGCCAAGTCAATCA
 +
 +
5′ pos: 6
 +
 +
3′ pos: 23
 +
 +
len: 18
 +
 +
Tm: 55.35
 +
 +
5′ dG: -5.07
 +
 +
3′ dG: -4.07
 +
 +
% GC: 44
 +
 +
==Citations==
 +
1. Papadakis, G., Pantazis, A. K., Fikas, N., Chatziioannidou, S., Tsiakalou, V., Michaelidou, K., ... & Gizeli, E. (2022). Portable real-time colorimetric LAMP-device for rapid quantitative detection of nucleic acids in crude samples. Scientific reports, 12(1), 1-15.
 +
 +
2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>

Latest revision as of 05:28, 12 October 2022


BRAF V600E F3

Sequence used in wetlab experiments: GGAAAATGAGATCTACTG is taken from [1]

Usage and Biology

This is the sequence for the outer forward primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the BRAF V600E: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGA GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG

Dilutions

Storage Primer Concentration: 100 μM

10X Concentration (Stock): 16 μM

Volume of 10X primer mix: 10 μL

1X Concentration (Final):1.6 μM

Volume of storage primer needed: 0.2 μL

Mixed with B3, FIP, BIP, LF and LB for a total of 4.4 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington

Alternative Sequence

As this set of primer failed to produce a positive result, we used NEB LAMP Primer Design Tool (https://lamp.neb.com/#!/) to generate an alternative set of primers. Unfortunately, due to time and budgetary constraints, these primers have not been ordered and experimented with yet.

Sequence: TACACGCCAAGTCAATCA

5′ pos: 6

3′ pos: 23

len: 18

Tm: 55.35

5′ dG: -5.07

3′ dG: -4.07

% GC: 44

Citations

1. Papadakis, G., Pantazis, A. K., Fikas, N., Chatziioannidou, S., Tsiakalou, V., Michaelidou, K., ... & Gizeli, E. (2022). Portable real-time colorimetric LAMP-device for rapid quantitative detection of nucleic acids in crude samples. Scientific reports, 12(1), 1-15.

2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 9
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]