Difference between revisions of "Part:BBa K4274008"
 
(7 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
 
−
__NOTOC__
 
 
<partinfo>BBa_K4274008 short</partinfo>
 
<partinfo>BBa_K4274008 short</partinfo>
−
tcgggaagatcagggatgca
 
  
 
Guide RNA (gRNA) is used as a molecule that helps with the cleavage of DNA since it guides the Cas nuclease to a targeted dsDNA sequence.  As a gRNA, sfp_target is used for knocking-out the natural, invalid sfp gene, and then knocking-in sfp (Part number:BBa_K4274009) and degQ(Part number:BBa_K4274010) gene in the genome of <i>Bacillus subtilis</i>.  
 
Guide RNA (gRNA) is used as a molecule that helps with the cleavage of DNA since it guides the Cas nuclease to a targeted dsDNA sequence.  As a gRNA, sfp_target is used for knocking-out the natural, invalid sfp gene, and then knocking-in sfp (Part number:BBa_K4274009) and degQ(Part number:BBa_K4274010) gene in the genome of <i>Bacillus subtilis</i>.  
  
−
==Usage and biology==
+
==Usage and Biology==
−
Single-guide RNA (sgRNA) is RNA designed artifially to be able to bind to a DNA sequence. It combines with the Cas9 protein to work to cleave the target RNA and though it is slightly shorter, it has the same function as the original RNAs in the CRISPR/Cas9 system. We designed the sfp_target(gRNA) to target  the region of the natural sfp gene to knock-out and simultaneously knock-in sfp (Part number:BBa_K4274009) and degQ (Part number:BBa_K4274010) gene in situ. After the sucessful modification, Bacillus subtilis 168 was allowed to produce fengycins. This could be reused by other teams to edit the genome of Bacillus subtilis and thus realize fengycins’ production.
+
Single-guide RNA (sgRNA) is RNA designed artifially to be able to bind to a DNA sequence. It combines with the Cas9 protein to work to cleave the target RNA and though it is slightly shorter, it has the same function as the original RNAs in the CRISPR/Cas9 system. We designed the sfp_target(gRNA) to target  the region of the natural sfp gene to knock-out and simultaneously knock-in sfp (Part number:BBa_K4274009) and degQ (Part number:BBa_K4274010) gene in situ. After the sucessful modification, <i>Bacillus subtilis</i> 168 was allowed to produce fengycins. This could be reused by other teams to edit the genome of <i>Bacillus subtilis</i> and thus realize fengycins’ production.
−
 
+
 
==Source==
 
==Source==
  
 
<i>Bacillus subtilis</i>
 
<i>Bacillus subtilis</i>
−
 
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
  
 
==Sequence and Features==
 
==Sequence and Features==
−
<span class='h3bb'>Sequence and Features</span>
 
 
<partinfo>BBa_K4274008 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K4274008 SequenceAndFeatures</partinfo>
  
−
 
+
<!--Uncomment this to enable Functional Parameter display
−
<!-- Uncomment this to enable Functional Parameter display  
+
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K4274008 parameters</partinfo>
 
<partinfo>BBa_K4274008 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
==Reference==
 +
[1]Chen X.H., Koumoutsi A., Scholz R., et al. More than Anticipated – Production of Antibiotics and Other Secondary Metabolites by Bacillus amyloliquefaciens FZB42. Mircrobial Biotech. 16 (2), 14-24 (2009). https://doi.org/10.1159/000142891.
 +
 +
[2]Jin P., Wang H., Liu W., et al. Characteriztion of IpaH2 gene corresponding to lipopeptide synthesis in Bacillus amyloliquefaciens HAB-2. BMC Microbio. 17 (2), 227 (2017). https://doi.org/10.1186/s12866-017-1134-z.
 +
 +
[3]Tsuge K., Ano T., Hirai M., et al. The Genes degQ, pps, and Ipa-8(sfp) Are Responsible for Conversion of Bacillus subtilis 168 to Plipastin Production. Antimicrobial Agents and Chemo. 43(9), 2183-2192 (1999). https://doi.org/10.1128/AAC.43.9.2183.

Latest revision as of 05:09, 12 October 2022

sfp_target(gRNA)

Guide RNA (gRNA) is used as a molecule that helps with the cleavage of DNA since it guides the Cas nuclease to a targeted dsDNA sequence. As a gRNA, sfp_target is used for knocking-out the natural, invalid sfp gene, and then knocking-in sfp (Part number:BBa_K4274009) and degQ(Part number:BBa_K4274010) gene in the genome of Bacillus subtilis.

Usage and Biology

Single-guide RNA (sgRNA) is RNA designed artifially to be able to bind to a DNA sequence. It combines with the Cas9 protein to work to cleave the target RNA and though it is slightly shorter, it has the same function as the original RNAs in the CRISPR/Cas9 system. We designed the sfp_target(gRNA) to target the region of the natural sfp gene to knock-out and simultaneously knock-in sfp (Part number:BBa_K4274009) and degQ (Part number:BBa_K4274010) gene in situ. After the sucessful modification, Bacillus subtilis 168 was allowed to produce fengycins. This could be reused by other teams to edit the genome of Bacillus subtilis and thus realize fengycins’ production.

Source

Bacillus subtilis

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Reference

[1]Chen X.H., Koumoutsi A., Scholz R., et al. More than Anticipated – Production of Antibiotics and Other Secondary Metabolites by Bacillus amyloliquefaciens FZB42. Mircrobial Biotech. 16 (2), 14-24 (2009). https://doi.org/10.1159/000142891.

[2]Jin P., Wang H., Liu W., et al. Characteriztion of IpaH2 gene corresponding to lipopeptide synthesis in Bacillus amyloliquefaciens HAB-2. BMC Microbio. 17 (2), 227 (2017). https://doi.org/10.1186/s12866-017-1134-z.

[3]Tsuge K., Ano T., Hirai M., et al. The Genes degQ, pps, and Ipa-8(sfp) Are Responsible for Conversion of Bacillus subtilis 168 to Plipastin Production. Antimicrobial Agents and Chemo. 43(9), 2183-2192 (1999). https://doi.org/10.1128/AAC.43.9.2183.