Difference between revisions of "Part:BBa K4441001"

Revision as of 02:25, 12 October 2022

BRAF WT B3

200 219 20 56.40 -4.76 -4.23 45 TCTGACTGAAAGCTGTATGG

Sequence and Features

Assembly Compatibility:

@@ Line 7: / Line 7: @@
 <!-- Add more about the biology of this part here
 ===Usage and Biology===
+This is the sequence for the outer backward primer. The outer backward primer consists of a B3 region which is complementary to the B3c region of the template sequence [2]. The outer primer B3 hybridizes to B3c region of the target DNA and extends, displacing the BIP linked complementary strand and resulting in the formation of a dumbbell shaped DNA [2]. This B3 primer is part of the primer set that detects the WT BRAF: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG
+==Citations==
+. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996.
+. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html
 <!-- -->
 <span class='h3bb'>Sequence and Features</span>