Difference between revisions of "Part:BBa K4221014"

 
 
(3 intermediate revisions by one other user not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4221014 short</partinfo>
 
<partinfo>BBa_K4221014 short</partinfo>
−
 
−
 
−
 
−
 
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->
Line 18: Line 12:
 
<partinfo>BBa_K4221014 parameters</partinfo>
 
<partinfo>BBa_K4221014 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===Usage===
 +
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
 +
 +
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA.
 +
Using mHoneydew[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
 +
 +
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.
 +
 +
===Biology===
 +
Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]
 +
 +
BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis.
 +
It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[4]
 +
 +
===Design Consideration===
 +
The construct was cloned into a PET28a plasmid and transformed into BL21 (DE3) E. coli.
 +
 +
The construction includes:
 +
 +
mHoneydew is fused with BslA with a TEVlinker（GAAAACCTGTACTTCCAGGGTTCTGGT）
 +
 +
===Reference===
 +
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)
 +
 +
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
 +
 +
[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.
 +
 +
[4]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110
 +
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===

Latest revision as of 06:43, 11 October 2022


mHoneydew-TEVlinker-BslA(42-181aa)

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 104
    Illegal AgeI site found at 555
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.

Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using mHoneydew[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.

Biology

Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]

BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis. It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[4]

Design Consideration

The construct was cloned into a PET28a plasmid and transformed into BL21 (DE3) E. coli.

The construction includes:

mHoneydew is fused with BslA with a TEVlinker（GAAAACCTGTACTTCCAGGGTTCTGGT）

Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)

[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.

[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.

[4]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110