Difference between revisions of "Part:BBa K4221000"

(Protein Expression)
 
(4 intermediate revisions by 2 users not shown)
Line 14: Line 14:
 
===Usage===
 
===Usage===
 
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.
 
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.
Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and RGD-targeted peptide
+
Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and the PET degrading efficiency of degrading enzyme mPETase.
  
 
===Biology===
 
===Biology===
Line 21: Line 21:
  
 
===Design Consideration===
 
===Design Consideration===
The construct was cloned into a pET28a plasmid and transformed into BL21 (DE3) E. coli.  
+
The construct was cloned into a pET28a plasmid and transformed into BL21 (DE3) E. coli and Rosetta E. coli.
 +
 
 
The construction includes:  
 
The construction includes:  
  
 
1. a 6× His tag (MGHHHHHHM) is added to enable us carrying out Ni-NTA protein purification
 
1. a 6× His tag (MGHHHHHHM) is added to enable us carrying out Ni-NTA protein purification
  
2. The CT fused with BslA with a GS linker (three Glycine Serine repeat: GSGSGS)
+
2. The CT fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT)
  
3. The CT fused with BslA with a TEV linker
+
3. The CT fused with BslA with a TEV linker(GAAAACCTGTACTTCCAGGGTTCTGGT)
  
 
===Protein Expression===
 
===Protein Expression===
  
We transformed 4 recombinant plasmids (pET28a-EBFP-GSlinker-BslA, pET28a-mHoneydew-GSlinker-BslA, pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains.
+
We transformed 3 recombinant plasmids (pET28a-EBFP-GSlinker-BslA, pET28a-mHoneydew-GSlinker-BslA, pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains.
  
 
[[File:figure-2 a .png|500px]]<br>
 
[[File:figure-2 a .png|500px]]<br>
'''Figure 1.'''
 
 
(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 
  
 
[[File:figure-2 b .png|500px]]<br>
 
[[File:figure-2 b .png|500px]]<br>
  
'''Figure 1.'''
+
'''Figure 1.'''(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 
+
 
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
 
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
  
 
[[File:figure-3 a .png|500px]]<br>
 
[[File:figure-3 a .png|500px]]<br>
 
'''Figure 2.'''
 
 
(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 
  
 
[[File:figure-3 b .png|500px]]<br>
 
[[File:figure-3 b .png|500px]]<br>
  
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,  
+
'''Figure 2.'''(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,  
  
 
[[File:figure-4 a .png|500px]]<br>
 
[[File:figure-4 a .png|500px]]<br>
'''Figure 3.'''
 
 
(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h
 
M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 
  
 
[[File:figure-4 b .png|500px]]<br>
 
[[File:figure-4 b .png|500px]]<br>
  
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
+
'''Figure 3.'''(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h
 +
M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
  
 
[[File:figure-5 a .png|500px]]<br>
 
[[File:figure-5 a .png|500px]]<br>
'''Figure 4.'''
 
 
(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h
 
M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 
  
 
[[File:figure-5 b .png|500px]]<br>
 
[[File:figure-5 b .png|500px]]<br>
 
+
'''Figure 4.'''(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,  
+
M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,  
  
 
[[File:figure-6 a .png|500px]]<br>
 
[[File:figure-6 a .png|500px]]<br>
'''Figure 5.'''
 
 
(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h
 
M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 
  
 
[[File:figure-6 b .png|500px]]<br>
 
[[File:figure-6 b .png|500px]]<br>
  
(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,   
+
'''Figure 5.''' (a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h
 +
M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,   
  
 
[[File:figure-7 a .png|500px]]<br>
 
[[File:figure-7 a .png|500px]]<br>
'''Figure 6.'''
 
 
(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h
 
M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 
  
 
[[File:figure-7 b .png|500px]]<br>
 
[[File:figure-7 b .png|500px]]<br>
  
(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,
+
'''Figure 6.'''(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h
 +
M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,
 +
 
 +
 
 +
===Detection of fusion protein function===
 +
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant (use 1×PBS as buffer). In order to verify that the fusion protein (EBFP-GSlinker-BslA, mHoneydew-GSlinker-BslA, mOrange-GSlinker-BslA) was successfully fused and expressed compared to the control group (EBFP, mHoneydew, mOrange). We attempted to conduct water contact angle experiments. Due to experimental conditions, we cannot use professional instruments.
 +
We used parafilm as the substrate, which is an extremely hydrophobic interface, and added droplets of the supernatant of the control group and the supernatant of the fusion protein experimental group respectively for observation. We found that the contact angle of the control group was much smaller than that of the experimental group. This means that the supernatant of the control group was hydrophobic as a whole, while the experimental group was hydrophilic. BslA, as a hydrophobin, has the characteristic of reversing surface properties. Through this experiment, we can prove the existence of BslA in the experimental group.
 +
 
 +
[[File:figure-8 .png|500px]]<br>
 +
'''Figure 7.'''Water contact angle.
 +
 
 +
===Aqueous two-phase separation (ATPS) Testing===
 +
Then, we used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated. We found that the fluorescence color was still in the lower layer (aqueous phase) in both the experimental group and the control group.
 +
 
 +
In theory, fluorescence should appear in the upper layer (organic phase) because When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
 +
 
 +
Our experiments did not get perfect results, we analyzed some possible reasons and tried to continue experiments to explore in the future.
 +
 
 +
First, the current system is still small. Although we can see the fluorescence color, it is very shallow, and even though there may be some fluorescence in the organic phase, it is not visible to the naked eye due to the small amount. Therefore, we need to expand the system of protein-induced expression in the future.
 +
 
 +
Second, this may be related to the choice of buffer. We used 1xPBS to dissolve the supernatant obtained after sonication, and it may be possible to change the buffer of other pH to have different results.
 +
 
 +
Third, it may be related to the hydrophilicity and hydrophobicity of the supernatant. The supernatant contains all proteins expressed by the cells, including the target protein. Through the water contact angle experiment, we can find that the supernatant of the control group is hydrophobic as a whole, which may be caused by the hydrophobicity of some endogenous proteins in cells. Their presence may affect the function of BslA in the ATPS system.
 +
 
 +
 
 +
Based on a review published at 2016 (Iqbal,M. et al.), we assumed that other potential rationales that contribute unsuccessful partitioning of protein in ATPS might be unsuitable concentration of salt aqueous solution, unsuitable temperature and incorrect selection of solute in organic phase. Extremely high concentration of salts may alter the hydrophobicity of biomolecules. As a consequence of the hydrophobic ions force the partitioning of counter ions to phase with higher hydrophobicity and vice versa. Thereafter, the addition of salts has critical influence on the partitioning coefficient based on following equation. The temperature can alter the coefficient as well. Moreover, it can generate effect on partitioning through the through viscosity and density.
 +
 
 +
[[File:figure-9 b .png|500px]]<br>
 +
'''Figure 8.''' ATPS testing.
  
 
===References===
 
===References===

Latest revision as of 06:26, 11 October 2022


BslA (42-181aa)

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage

In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method. Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and the PET degrading efficiency of degrading enzyme mPETase.

Biology

BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis. It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[1]

Design Consideration

The construct was cloned into a pET28a plasmid and transformed into BL21 (DE3) E. coli and Rosetta E. coli.

The construction includes:

1. a 6× His tag (MGHHHHHHM) is added to enable us carrying out Ni-NTA protein purification

2. The CT fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT)

3. The CT fused with BslA with a TEV linker(GAAAACCTGTACTTCCAGGGTTCTGGT)

Protein Expression

We transformed 3 recombinant plasmids (pET28a-EBFP-GSlinker-BslA, pET28a-mHoneydew-GSlinker-BslA, pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains.

Figure-2 a .png

Figure-2 b .png

Figure 1.(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG (b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-3 a .png

Figure-3 b .png

Figure 2.(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-4 a .png

Figure-4 b .png

Figure 3.(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-5 a .png

Figure-5 b .png
Figure 4.(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-6 a .png

Figure-6 b .png

Figure 5. (a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,

Figure-7 a .png

Figure-7 b .png

Figure 6.(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,


Detection of fusion protein function

After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant (use 1×PBS as buffer). In order to verify that the fusion protein (EBFP-GSlinker-BslA, mHoneydew-GSlinker-BslA, mOrange-GSlinker-BslA) was successfully fused and expressed compared to the control group (EBFP, mHoneydew, mOrange). We attempted to conduct water contact angle experiments. Due to experimental conditions, we cannot use professional instruments. We used parafilm as the substrate, which is an extremely hydrophobic interface, and added droplets of the supernatant of the control group and the supernatant of the fusion protein experimental group respectively for observation. We found that the contact angle of the control group was much smaller than that of the experimental group. This means that the supernatant of the control group was hydrophobic as a whole, while the experimental group was hydrophilic. BslA, as a hydrophobin, has the characteristic of reversing surface properties. Through this experiment, we can prove the existence of BslA in the experimental group.

Figure-8 .png
Figure 7.Water contact angle.

Aqueous two-phase separation (ATPS) Testing

Then, we used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated. We found that the fluorescence color was still in the lower layer (aqueous phase) in both the experimental group and the control group.

In theory, fluorescence should appear in the upper layer (organic phase) because When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.

Our experiments did not get perfect results, we analyzed some possible reasons and tried to continue experiments to explore in the future.

First, the current system is still small. Although we can see the fluorescence color, it is very shallow, and even though there may be some fluorescence in the organic phase, it is not visible to the naked eye due to the small amount. Therefore, we need to expand the system of protein-induced expression in the future.

Second, this may be related to the choice of buffer. We used 1xPBS to dissolve the supernatant obtained after sonication, and it may be possible to change the buffer of other pH to have different results.

Third, it may be related to the hydrophilicity and hydrophobicity of the supernatant. The supernatant contains all proteins expressed by the cells, including the target protein. Through the water contact angle experiment, we can find that the supernatant of the control group is hydrophobic as a whole, which may be caused by the hydrophobicity of some endogenous proteins in cells. Their presence may affect the function of BslA in the ATPS system.


Based on a review published at 2016 (Iqbal,M. et al.), we assumed that other potential rationales that contribute unsuccessful partitioning of protein in ATPS might be unsuitable concentration of salt aqueous solution, unsuitable temperature and incorrect selection of solute in organic phase. Extremely high concentration of salts may alter the hydrophobicity of biomolecules. As a consequence of the hydrophobic ions force the partitioning of counter ions to phase with higher hydrophobicity and vice versa. Thereafter, the addition of salts has critical influence on the partitioning coefficient based on following equation. The temperature can alter the coefficient as well. Moreover, it can generate effect on partitioning through the through viscosity and density.

Figure-9 b .png
Figure 8. ATPS testing.

References

[1]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110