Difference between revisions of "Part:BBa K4221000"
(→Design Consideration) |
|||
Line 14: | Line 14: | ||
===Usage=== | ===Usage=== | ||
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method. | In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method. | ||
− | Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and | + | Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and the PET degrading efficiency of degrading enzyme mPETase. |
===Biology=== | ===Biology=== | ||
Line 32: | Line 32: | ||
===Protein Expression=== | ===Protein Expression=== | ||
− | We transformed | + | We transformed 3 recombinant plasmids (pET28a-EBFP-GSlinker-BslA, pET28a-mHoneydew-GSlinker-BslA, pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains. |
[[File:figure-2 a .png|500px]]<br> | [[File:figure-2 a .png|500px]]<br> |
Revision as of 06:10, 11 October 2022
BslA (42-181aa)
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Usage
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method. Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and the PET degrading efficiency of degrading enzyme mPETase.
Biology
BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis. It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[1]
Design Consideration
The construct was cloned into a pET28a plasmid and transformed into BL21 (DE3) E. coli. The construction includes:
1. a 6× His tag (MGHHHHHHM) is added to enable us carrying out Ni-NTA protein purification
2. The CT fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT)
3. The CT fused with BslA with a TEV linker(GAAAACCTGTACTTCCAGGGTTCTGGT)
Protein Expression
We transformed 3 recombinant plasmids (pET28a-EBFP-GSlinker-BslA, pET28a-mHoneydew-GSlinker-BslA, pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains.
(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
Figure 1.
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
Figure 2.
(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
Figure 2.
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
Figure 3.
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
Figure 5.
(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,
(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
Figure 6.
(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,
References
[1]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110