Difference between revisions of "Part:BBa K4221000"

(Design Consideration)
Line 14: Line 14:
 
===Usage===
 
===Usage===
 
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.
 
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.
Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and RGD-targeted peptide
+
Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and the PET degrading efficiency of degrading enzyme mPETase.
  
 
===Biology===
 
===Biology===
Line 32: Line 32:
 
===Protein Expression===
 
===Protein Expression===
  
We transformed 4 recombinant plasmids (pET28a-EBFP-GSlinker-BslA, pET28a-mHoneydew-GSlinker-BslA, pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains.
+
We transformed 3 recombinant plasmids (pET28a-EBFP-GSlinker-BslA, pET28a-mHoneydew-GSlinker-BslA, pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains.
  
 
[[File:figure-2 a .png|500px]]<br>
 
[[File:figure-2 a .png|500px]]<br>

Revision as of 06:10, 11 October 2022


BslA (42-181aa)

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage

In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method. Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide and the PET degrading efficiency of degrading enzyme mPETase.

Biology

BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis. It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[1]

Design Consideration

The construct was cloned into a pET28a plasmid and transformed into BL21 (DE3) E. coli. The construction includes:

1. a 6× His tag (MGHHHHHHM) is added to enable us carrying out Ni-NTA protein purification

2. The CT fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT)

3. The CT fused with BslA with a TEV linker(GAAAACCTGTACTTCCAGGGTTCTGGT)

Protein Expression

We transformed 3 recombinant plasmids (pET28a-EBFP-GSlinker-BslA, pET28a-mHoneydew-GSlinker-BslA, pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains.

Figure-2 a .png
Figure 1.

(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-2 b .png

Figure 1.

(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-3 a .png

Figure 2.

(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-3 b .png

Figure 2.

(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-4 a .png
Figure 3.

(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-4 b .png

Figure 3.

(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-5 a .png
Figure 4.

(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-5 b .png
Figure 4.

(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-6 a .png
Figure 5.

(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-6 b .png

Figure 5.

(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,

Figure-7 a .png
Figure 6.

(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-7 b .png

Figure 6.

(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,

References

[1]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110