Difference between revisions of "Part:BBa K4197009"

Latest revision as of 18:39, 10 October 2022

Gal d 2_OmpA fusion

Gene fusion to express the egg allergen Gal d 2 on the surface of E. coli.

Introduction

This part is composed of the gene coding for the allergen of hen’s egg Gal d 2 (NCBI: V00383.1). The hen's egg allergy prevalence is 0,5-2,5% in developped countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in E. coli and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015). Gal d 2 was merged to the membrane protein OmpA of E. coli (BBa_K1694002) to display Gal d 2 on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

OmpA_Gal d 2 fragment from IDT gblock was amplified by PCR using the high fidelity Phusion polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg) and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. Expected size of the amplicon was 1675 bp.

pET-21 b (+) vector was linearized by PCR using the high fidelity Phusion polymerase with primers FORWARD:tgtcgacggagctcgaattcg and REVERSE:ttaaagcttgcggccgcactcg. Expected size of the amplicon was 5442 bp.

Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 1).

Figure 1: pET-21 b (+) linearized (A) and Gal d 2 amplified fragment (B). Expected sizes of the amplicons were 5442 bp (A) and 1675 bp (B). PCR amplicon sizes of pET-21 b (+) (A) and Gal d 2 (B) were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels. (note that a different ladder is presented on the theoretical gel).

Amplification products matched the expected size, they were further purified from gel.

The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone (FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc, expected size of the amplicon : 2092 bp). 2 positive transformants were detected (Figure 3).

Figure 2: identifying fragments that bear pET21 b (+)_Ompa_Gal d 2 by colony PCR. Expected size of the amplicon was 2092 bp. The positive clones were colonies 17 and 24. PCR amplicon sizes of colonies with Gal d 2 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).