Difference between revisions of "Part:BBa K4197007"
 
(5 intermediate revisions by 2 users not shown)
Line 1: Line 1:
  
 
__NOTOC__
 
__NOTOC__
−
<partinfo>BBa_K4197003 short</partinfo>
+
<partinfo>BBa_K4197007 short</partinfo>
  
−
OmpA_ana o 3 fusion to display cashew allergen.
+
OmpA_Ana o 3 fusion to display cashew allergen on the <i>E. coli</i> cell surface.
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: <a "https://www.ncbi.nlm.nih.gov/protein/AAL91665.1/">AAL91665.1</a>). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy  (Sato and al. 2019). Ana o 3 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of <i>E. coli</i> (<a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>), to display Ana o 3 on the surface of <i>E. coli </i>. This lipoprotein is the most abundant in <i>E. coli's </i>membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).</p>
+
<p>This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: <a "https://www.ncbi.nlm.nih.gov/protein/AAL91665.1/">AAL91665.1</a>). The cashew allergy prevalence is higher than 0.08% in the US countries (Van der Valk and al. 2014) and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy  (Sato and al. 2019). Ana o 3 has already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of <i>E. coli</i> (<a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>) to display Ana o 3 on the surface of <i>E. coli </i>. This lipoprotein is the most abundant in <i>E. coli</i>'s membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).</p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Ana o 3 gene ordered on IDT (shown above in Figure 12) was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Ana o 3 (cctgtattttcagagcatggcgaaatttcttttattattg). Expected size of the amplicon was  479 bp.</p>
+
<p>Ana o 3 gene ordered on IDT was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Ana o 3 (cctgtattttcagagcatggcgaaatttcttttattattg). Expected size of the amplicon was  479 bp.</p>
  
−
<p>Amplification product sizes were checked on EtBr stained agarose gel (Figure 13).</p>
+
<p>Amplification product sizes were checked on EtBr stained agarose gel (Figure 1).</p>
  
  
Line 26: Line 26:
 
                         <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-fragment.png" class="internal" title="Enlarge"></a>
 
                         <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-fragment.png" class="internal" title="Enlarge"></a>
 
                     </div>
 
                     </div>
−
                     <i><b>Figure 13: Ana o 3 amplified fragment. Expected size of the amplicons was 479 bp.</b> PCR amplicon sizes Ana o 3 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i>
+
                     <i><b>Figure 1: Ana o 3 amplified fragment. Expected size of the amplicons was 479 bp.</b> PCR amplicon sizes Ana o 3 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i>
 
                 </div>
 
                 </div>
 
             </div>
 
             </div>
Line 36: Line 36:
  
  
−
<p>The products matched expected sizes and amplicons were further purified from the gel. The Ana o 3 construction was inserted into pET-21 b (+)_OmpA linearized (see Figure 6) by In-Fusion.</p>
+
<p>The products matched expected sizes and amplicons were further purified from the gel. The Ana o 3 construction was inserted into pET-21 b (+)_OmpA linearized by In-Fusion.</p>
  
−
<p>In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc). 4 positive transformants were detected (Figure 14).</p>
+
<p>In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc). 4 positive transformants were detected (Figure 2).</p>
  
  
Line 53: Line 53:
 
                         <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-screening.png" class="internal" title="Enlarge"></a>
 
                         <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-screening.png" class="internal" title="Enlarge"></a>
 
                     </div>
 
                     </div>
−
                     <i><b>Figure 14: pET21 b (+)_OmpA_Ana o 3 construction fragments from colony PCR.</b> PCR amplicon sizes of colonies with Ana o 3 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i>
+
                     <i><b>Figure 2: pET21 b (+)_OmpA_Ana o 3 construction fragments from colony PCR.</b> PCR amplicon sizes of colonies with Ana o 3 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i>
 
                 </div>
 
                 </div>
 
             </div>
 
             </div>
Line 62: Line 62:
  
  
−
<p>These transformants (colonies 1, 3 and 9) had their plasmid extracted by Miniprep and digested by Eco-RI and Eco-RV (expected size of the fragments:  5052 bp and 3211 pb) to assess the assembly (Figure 15).</p>
+
<p>These transformants (colonies 1, 3 and 9) had their plasmid extracted by Miniprep and digested by Eco-RI and Eco-RV (expected size of the fragments:  5052 bp and 3211 pb) to assess the assembly (Figure 3).</p>
  
  
Line 78: Line 78:
 
                         <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-digestion.png" class="internal" title="Enlarge"></a>
 
                         <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-digestion.png" class="internal" title="Enlarge"></a>
 
                     </div>
 
                     </div>
−
                     <i><b>Figure 15: restriction profile of pET-21 b (+)_Ana o 3 final construction. Enzymes were EcoRI and EcoRV.</b> Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i>
+
                     <i><b>Figure 3: restriction profile of pET-21 b (+)_Ana o 3 final construction. Enzymes were EcoRI and EcoRV.</b> Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i>
 
                 </div>
 
                 </div>
 
             </div>
 
             </div>
Line 91: Line 91:
 
<p>The plasmid was finally used to transform <i>E. coli</i> Tuner cells to express the OmpA_Ana o 3 construction at the cell membrane.</p>
 
<p>The plasmid was finally used to transform <i>E. coli</i> Tuner cells to express the OmpA_Ana o 3 construction at the cell membrane.</p>
  
−
<p>Achievements so far: we managed to have all our allergen construction correctly cloned.</p>
 
  
 
 
Line 133: Line 132:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
−
<partinfo>BBa_K4197003 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4197007 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
−
<partinfo>BBa_K4197003 parameters</partinfo>
+
<partinfo>BBa_K4197007 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 18:38, 10 October 2022


OmpA_Ana o 3 fusion

OmpA_Ana o 3 fusion to display cashew allergen on the E. coli cell surface.

Introduction

This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: AAL91665.1). The cashew allergy prevalence is higher than 0.08% in the US countries (Van der Valk and al. 2014) and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy (Sato and al. 2019). Ana o 3 has already been expressed in E. coli and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of E. coli (BBa_K1694002) to display Ana o 3 on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Ana o 3 gene ordered on IDT was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Ana o 3 (cctgtattttcagagcatggcgaaatttcttttattattg). Expected size of the amplicon was 479 bp.

Amplification product sizes were checked on EtBr stained agarose gel (Figure 1).

Figure 1: Ana o 3 amplified fragment. Expected size of the amplicons was 479 bp. PCR amplicon sizes Ana o 3 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The products matched expected sizes and amplicons were further purified from the gel. The Ana o 3 construction was inserted into pET-21 b (+)_OmpA linearized by In-Fusion.

In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc). 4 positive transformants were detected (Figure 2).

Figure 2: pET21 b (+)_OmpA_Ana o 3 construction fragments from colony PCR. PCR amplicon sizes of colonies with Ana o 3 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

These transformants (colonies 1, 3 and 9) had their plasmid extracted by Miniprep and digested by Eco-RI and Eco-RV (expected size of the fragments: 5052 bp and 3211 pb) to assess the assembly (Figure 3).

Figure 3: restriction profile of pET-21 b (+)_Ana o 3 final construction. Enzymes were EcoRI and EcoRV. Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The correct restriction maps were observed and these clones were further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Ana o 3.

The plasmid was finally used to transform E. coli Tuner cells to express the OmpA_Ana o 3 construction at the cell membrane.

Validation

The plasmid was eventually used to transform E. coli Tuner cells in order to express the OmpA_Ana o 3 construction at the cell membrane. The expression and display controls should have been conducted using anti-Ana o 3 antibodies to check wether the allergen displayed on the bacteria were able to link to their specific IgE. However, due to the high price of these IgE, the experiment was not performed.

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Der p 2
- OmpA_Gal d 2

  1. Van der Valk, J. P. M., J. Dubois, A. E., Gerth van Wijk, R., Wichers, H. J., de Jong, N. W. (2014). Systematic review on cashew nut allergy. Allergy. 69(6), 692–698. doi:10.1111/all.12401
  2. Sato, S., Movérare, R., Ohya, Y., Ito, K., Nagao, M., Borres, M. P., & Ebisawa, M. (2019). Ana o 3–specific IgE is a predictive marker for cashew oral food challenge failure. The Journal of Allergy and Clinical Immunology : In Practice, 7(8), 2909–2911.e4. https://doi.org/10.1016/j.jaip.2019.04.049
  3. Robotham, J. M., Wang, F., Seamon, V., Teuber, S. S., Sathe, S. K., Sampson, H. A., Beyer, K., Seavy, M., & Roux, K. H. (2005). Ana o 3, an important cashew nut (Anacardium occidentale L.) allergen of the 2S albumin family. Journal of Allergy and Clinical Immunology, 115(6), 1284–1290.
  4. Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
  5. Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001
    6.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 130
    Illegal NheI site found at 92
    Illegal NotI site found at 1086
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 130
    Illegal BamHI site found at 124
    Illegal XhoI site found at 1095
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 757