Difference between revisions of "Part:BBa K4197002"
 
(4 intermediate revisions by one other user not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197002 short</partinfo>
 
<partinfo>BBa_K4197002 short</partinfo>
−
 
−
Brick expressing Der p 1 at the surface of E. coli cell sortable by FACS
 
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>The part expressing the gene of The part expressing the gene of of dust mite Gal d 2 (<a href="https://parts.igem.org/Part:BBa_K4197006">K4197006</a>) has been completed with the ihfb800-RFP
+
<p>The mRFP1 fluorescent reporter has been added on the plasmid allowing to express the gene of dust mite Der p 1 (<a href="https://parts.igem.org/Part:BBa_K4197006">K4197006</a>) on the surface of <i>E. coli</i>. Expression of mRFP1 is driven by  the ihfb800 promoter (see <a href="https://parts.igem.org/Part:BBa_K41970012">K41970012</a>).
−
construction (<a href="https://parts.igem.org/Part:BBa_K41970012">K41970012</a>) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.  
+
This red fluorescence is destined to identify the allergen expressing cells by FACS.  
 
</p>
 
</p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
 
<p>The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R  
 
<p>The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R  
−
(cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622  
+
(cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon was obtain at 1622 bp (data not shown).</p>
−
bp. </p>
+
<p>Unfortunately, we were not able to linearize the plasmid containing the gene of dust mite.</p>
−
<p>We were not able to linearize the plasmid containing the gene of dust mite (<a href="https://parts.igem.org/Part:BBa_K4197006">K4197006</a>).</p>
+
  
−
<h2>References</h2>
+
<h2>DAISY Project</h2>
 
<ol>
 
<ol>
−
<li> <a href="https://parts.igem.org/Part:BBa_K4197009">K4197009</a> </li>
+
<li> <a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </li>
−
<li> <a href="https://parts.igem.org/Part:BBa_K4197012">K4197012</a> </li>
+
−
<li> <a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </li>
+
 
</ol>
 
</ol>
  
Line 33: Line 28:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
−
<partinfo>BBa_K4197003 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4197002 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
−
<partinfo>BBa_K4197003 parameters</partinfo>
+
<partinfo>BBa_K4197002 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 18:33, 10 October 2022


Der p 1 expression at the surface of E. coli cells sortable by FACS cells using mRFP1

Introduction

The mRFP1 fluorescent reporter has been added on the plasmid allowing to express the gene of dust mite Der p 1 (K4197006) on the surface of E. coli. Expression of mRFP1 is driven by the ihfb800 promoter (see K41970012). This red fluorescence is destined to identify the allergen expressing cells by FACS.

Construction

The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon was obtain at 1622 bp (data not shown).

Unfortunately, we were not able to linearize the plasmid containing the gene of dust mite.

DAISY Project

  1. DAISY (INSA-UPS 2022)

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal NheI site found at 1703
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1519
    Illegal NotI site found at 3243
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal BglII site found at 1592
    Illegal BamHI site found at 1735
    Illegal XhoI site found at 3252
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1360
    Illegal AgeI site found at 1472
  • 1000
    COMPATIBLE WITH RFC[1000]